* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $500.00.
CC-6043 PH198 x CC-124 [PH210]
$30.00
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023
This is a strain with a point mutation E90Q in ChR2 and disrupted ChR1, which was generated with CRISPR/Cas9. The original strain PH198 with CC125 as a background was crossed into CC124.
Background strain: PH198, CC124 mt-
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); CTATGTGTGCGCTATCGAGG (ChR2)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.