CC-5391 ∆PHOT-C41 mt+ [PH13]

$30.00

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, February 2018

This is a phototropin disruption strain, generated with CRISPR/Cas9.

Background strain              CC-125
Nuclease                                (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                    pAphVII (pPH360)
Target gene                            Phototropin, PHOT, Cre03.g199000
Target sequence                   GCGCATCCTCAACTACACCAAGG (Exon 6)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de


Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 29, Issue 10