* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $1000.00. Subscriptions cannot be used for CLiP mutants, BACs nor fosmids.
pCrU6.4-SaPSY1/aphVIII (pPH331)
$30.00
From Andre Greiner, Peter Hegemann lab, Humboldt University-Berlin October 2017
Vector for guide RNA targeting the phytoene synthase gene PSY1 with scaffold for Staphylococcus aureus Cas9 (SaCas9), controlled by the U6 snRNA promoter #4. Vector contains an aphVIII cassette for selection on paromomycin.
Target: PSY1 (Cre02.g095092)
Protospacer: GCGCTGGATCTGGCCACGACCG
PAM: NGGRR
Selection in C. reinhardtii: paromomycin
Host strain: XL1-Blue
Selection in E. coli: ampicillin
Link to sequence and map
Sequence (.docx file)
Overview of all CRISPR/Cas9 plasmids from the Hegemann lab
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de