pCrU6.4-SaPSY1/aphVIII (pPH331)

$30.00

From Andre Greiner, Peter Hegemann lab, Humboldt University-Berlin October 2017

Vector for guide RNA targeting the phytoene synthase gene PSY1 with scaffold for Staphylococcus aureus Cas9 (SaCas9), controlled by the U6 snRNA promoter #4. Vector contains an aphVIII cassette for selection on paromomycin.

Target: PSY1 (Cre02.g095092)
Protospacer: GCGCTGGATCTGGCCACGACCG
PAM: NGGRR

Selection in C. reinhardtii: paromomycin
Host strain: XL1-Blue
Selection in E. coli: ampicillin
Link to sequence and map
Sequence (.docx file)

Overview of all CRISPR/Cas9 plasmids from the Hegemann lab

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de