Plasmids
pHR18
$30.00
$30.00
From Elizabeth Specht, Stephen Mayfield Lab, University of California-San Diego, May 2018
Vector: pBluescript
Origin: Created by seamless cloning of several different fragments; fully sequence-verified.
Insert: This construct contains two intact cassettes and one truncated cassette. The first intact cassette is the ARS2 coding sequence, driven by the chimeric HSP70-RBCS2 promoter and followed by its endogenous 3’ UTR; the CDS and 3’ UTR were amplified from cDNA harvested from a strain under sulfur starvation conditions. The second intact cassette is the ARG7 CDS, surrounded by its endogenous promoter/5’ UTR and 3’ UTR, which were amplified from genomic DNA of wild type CC1010 strain. The final, truncated cassette contains the 3’ half of the CDS of hygromycin resistance gene followed by the RBCS2 3’ UTR; upstream of this lies a 1.6kb intron that was amplified from CC1010 genomic DNA.
Total insert size is 9,093 bp.
Comment: This plasmid represents one half of the pair of plasmids designed to detect homologous recombination in C. reinhardtii. Upon recombination with its partner, pHR23, it will produce an intact, functional hygromycin resistance cassette. pHR18 is the plasmid that has been transformed into CC-1820 to create the strain B12.
Host strain: DH5α
Selection: Ampicillin resistant in E. coli; restores arginine prototrophy in arg7 Chlamydomonas mutants.
pHR23
$30.00
$30.00
From Elizabeth Specht, Stephen Mayfield Lab, University of California-San Diego, May 2018
Vector: pBluescript
Host strain: DH5a E. coli
Origin: Created by seamless cloning of several different fragments; fully sequence-verified.
Insert: This plasmid contains 4,360bp of homology to its complementing partner, pHR18, followed by one intact cassette for paromomycin resistance and one truncated cassette. The truncated cassette contains the 5’ half of the hygromycin resistance CDS, preceded by the beta-tubulin promoter and 5’ UTR, followed by a 1.6kb intron amplified from wild type strain CC-1010 genomic DNA.
Total insert size is 8,847 bp.
Comment: This plasmid represents one half of the pair of plasmids designed to detect homologous recombination in C. reinhardtii. Upon recombination with its partner, pHR18, it will produce an intact, functional hygromycin resistance cassette. pHR23 can be transformed directly into strain B12, which already harbors pHR18 in its genome, to screen for homologous recombination rate. Paromomycin resistance can be used to assess the ratio of recombinants to total transformation efficiency.
Host strain: DH5α
Selection: Ampicillin resistant in E. coli; paromomycin resistant in Chlamydomonas.
pOpt2_PsaD_aadA_Min
$30.00
$30.00
From Kyle Lauersen, Olaf Kruse lab, Bielefeld University-Germany, May 2018
This is a minimized version of the pOpt2 vector which contains only a gene of interest cassette for reporter fusion to the aadA spectinomycin resistance gene. The vector has full complementarity to the pOpt2 vectors and contains the PsaD chloroplast targeting peptide between NdeI-BamHI. Fusion proteins can be generated for desired targets in fusion to the aadA and spectinomycin resistance allows direct selection for expressing transformants. This selection works whether fusion proteins are targeted to the algal chloroplast or the cytoplasm.
Host strain: DH5α
Selection in E. coli: ampicillin
Wichmann J, Baier T, Wentnagel E, Lauersen KJ, Kruse O (2018) Tailored carbon partitioning for phototrophic production of (E)-α-bisabolene from the green microalga Chlamydomonas reinhardtii. Metab. Eng. 45:211–222
pLM017
$30.00
$30.00
From Luke Mackinder, University of York-UK, December 2018
pLM017: pLM005-EPYC1-Venus-3xFLAG
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: paromomycin
ackinder LC, Meyer MT, Mettler-Altmann T, Chen VK, Mitchell MC, Caspari O, Freeman Rosenzweig ES, Pallesen L, Reeves G, Itakura A, Roth R, Sommer F, Geimer S, Mühlhaus T, Schroda M, Goodenough U, Stitt M, Griffiths H, Jonikas MC (2016) A Repeat Protein Links Rubisco to Form the Eukaryotic Carbon-Concentrating Organelle. Proc Natl Acad Sci U S A. 113:5958–63
pLM035
$30.00
$30.00
From Luke Mackinder, University of York-UK, December 2018
pLM035: pLM006-RBCS1-mCherry-6xHis
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: Hygromycin
Mackinder LC, Meyer MT, Mettler-Altmann T, Chen VK, Mitchell MC, Caspari O, Freeman Rosenzweig ES, Pallesen L, Reeves G, Itakura A, Roth R, Sommer F, Geimer S, Mühlhaus T, Schroda M, Goodenough U, Stitt M, Griffiths H, Jonikas MC (2016) A Repeat Protein Links Rubisco to Form the Eukaryotic Carbon-Concentrating Organelle. Proc Natl Acad Sci U S A. 113:5958–63
Fea1_ble-2A-mCherry
$30.00
$30.00
From Paula Barjona, University of Erlangen-Nuremberg, December 2018
The constitutive promoter HSP70A/Rbcs2 in plasmid pBR9 was replaced by the PCR-amplified FEA1 inducible promoter from plasmid p5’Fea1-ARS2 yielding Fea1_Ble2A-mCherry.
Host strain: DH5α
Selection in E. coli: ampicillin
Barjona do Nascimento Coutinho P, Friedl C, Buchholz R, Stute SC (2017) Chemical regulation of Fea1 driven transgene expression in Chlamydomonas reinhardtii. Algal Research. 26:323–329
Rasala BA, Barrera DJ, Ng J, Plucinak TM, Rosenberg JN, Weeks DP, Oyler GA, Peterson TC, Haerizadeh F, Mayfield SP (2013) Expanding the spectral palette of fluorescent proteins for the green microalga Chlamydomonas reinhardtii. Plant J. 74:545-56
pRAM118_SAGA1_Venus_3xFLAG
$30.00
$30.00
From Jessica Hennacy, Martin Jonikas lab, Princeton University, August 2020
pRAM118 is derived from pLM005, but contains a hygromycin selectable marker in lieu of the paromomycin cassette. All other features remain the same.
Selection: ampicillin resistant in E. coli; hygromycin in Chlamydomonas
takura AK, Chan KX, Atkinson N, Pallesen L, Wang L, Reeves G, Patena W, Caspari O, Roth R, Goodenough U, McCormick AJ, Griffiths H, Jonikas MC. A Rubisco-binding protein is required for normal pyrenoid number and starch sheath morphology in Chlamydomonas reinhardtii. Proc Natl Acad Sci U S A. 2019 Sep 10;116(37):18445-18454. doi: 10.1073/pnas.1904587116. Epub 2019 Aug 27. PMID: 31455733; PMCID: PMC6744930.
pB6D2-cBCCP
$30.00
$30.00
From Erin Dymek, Elizabeth Smith lab, Dartmouth College, November 2019
C terminally BCCP tagged PF16 genomic clone in pBluescript
Fu G, Zhao L, Dymek E, Hou Y, Song K, Phan N, Shang Z, Smith EF, Witman GB, Nicastro D. Structural organization of the C1a-e-c supercomplex within the ciliary central apparatus. J Cell Biol. 2019 Dec 2;218(12):4236-4251. doi: 10.1083/jcb.201906006. Epub 2019 Oct 31. PMID: 31672705; PMCID: PMC6891083.
pPF15cHA
$30.00
$30.00
From Erin Dymek, Elizabeth Smith lab, Dartmouth College, November 2019
C terminal HA tagged PF15 genomic clone in pBluescript
Dymek EE, Lefebvre PA, Smith EF. PF15p is the chlamydomonas homologue of the Katanin p80 subunit and is required for assembly of flagellar central microtubules. Eukaryot Cell. 2004 Aug;3(4):870-9. doi: 10.1128/EC.3.4.870-879.2004. PMID: 15302820; PMCID: PMC500881.
pBCp60
$30.00
$30.00
From Erin Dymek, Elizabeth Smith lab, Dartmouth College, November 2019
Katanin p60 genomic clone in pBluescript
Dymek EE, Smith EF. PF19 encodes the p60 catalytic subunit of katanin and is required for assembly of the flagellar central apparatus in Chlamydomonas. J Cell Sci. 2012 Jul 15;125(Pt 14):3357-66. doi: 10.1242/jcs.096941. Epub 2012 Mar 30. PMID: 22467860; PMCID: PMC3516377.
pBCp60-GFP
$30.00
$30.00
From Erin Dymek, Elizabeth Smith lab, Dartmouth College, November 2019
GFP tagged katanin p60 genomic clone in pBluescript
Dymek EE, Smith EF. PF19 encodes the p60 catalytic subunit of katanin and is required for assembly of the flagellar central apparatus in Chlamydomonas. J Cell Sci. 2012 Jul 15;125(Pt 14):3357-66. doi: 10.1242/jcs.096941. Epub 2012 Mar 30. PMID: 22467860; PMCID: PMC3516377.
PACRG-pUC57
$30.00
$30.00
From Erin Dymek, Elizabeth Smith lab, Dartmouth College, November 2019
PACRG genomic clone in pUC57
Dymek EE, Lin J, Fu G, Porter ME, Nicastro D, Smith EF. PACRG and FAP20 form the inner junction of axonemal doublet microtubules and regulate ciliary motility. Mol Biol Cell. 2019 Jul 15;30(15):1805-1816. doi: 10.1091/mbc.E19-01-0063. Epub 2019 May 22. PMID: 31116684; PMCID: PMC6727744.
FAP20gen-pCR2.1
$30.00
$30.00
From Erin Dymek, Elizabeth Smith lab, Dartmouth College, November 2019
FAP20 genomic clone in pCR2.1
Dymek EE, Lin J, Fu G, Porter ME, Nicastro D, Smith EF. PACRG and FAP20 form the inner junction of axonemal doublet microtubules and regulate ciliary motility. Mol Biol Cell. 2019 Jul 15;30(15):1805-1816. doi: 10.1091/mbc.E19-01-0063. Epub 2019 May 22. PMID: 31116684; PMCID: PMC6727744.
PACRG-pET30a
$30.00
$30.00
From Erin Dymek, Elizabeth Smith lab, Dartmouth College, November 2019
PACRG cDNA clone in pET30a
Dymek EE, Lin J, Fu G, Porter ME, Nicastro D, Smith EF. PACRG and FAP20 form the inner junction of axonemal doublet microtubules and regulate ciliary motility. Mol Biol Cell. 2019 Jul 15;30(15):1805-1816. doi: 10.1091/mbc.E19-01-0063. Epub 2019 May 22. PMID: 31116684; PMCID: PMC6727744.
FAP20-pET30a
$30.00
$30.00
From Erin Dymek, Elizabeth Smith lab, Dartmouth College, November 2019
FAP20 cDNA clone in pET30a
Dymek EE, Lin J, Fu G, Porter ME, Nicastro D, Smith EF. PACRG and FAP20 form the inner junction of axonemal doublet microtubules and regulate ciliary motility. Mol Biol Cell. 2019 Jul 15;30(15):1805-1816. doi: 10.1091/mbc.E19-01-0063. Epub 2019 May 22. PMID: 31116684; PMCID: PMC6727744.
pSH001 (pSS1-ITP-D23A E24A)
$30.00
$30.00
From Shan He, Martin Jonikas lab, Princeton University, February 2020
Host strain: DH5α
Selection in E. coli: ampicillin/carbenicillin
pSH002 (pSS1-ITP M87D V94D)
$30.00
$30.00
From Shan He, Martin Jonikas lab, Princeton University, February 2020
Host strain: DH5α
Selection in E. coli: ampicillin/carbenicillin
From Gary Yates, Luke Mackinder lab, University of York-UK, July 2020
RBMP1 (Cre06.g261750) coding sequence plus 3672 bp upstream of the start codon was cloned into pLM099 by recombineering to produce a C-terminal CrVenus-3xFLAG tag. Transformed into C. reinhardtii strain CMJ030 to produce CC-5646.
Host strain: DH10B
Selection in E. coli: kanamycin
Selection in C. reinhardtii: paromomycin
https://www.biorxiv.org/content/10.1101/2020.08.16.252858v1.full
From Gary Yates, Luke Mackinder lab, University of York-UK, July 2020
RBMP2 (Cre09.g416850) coding sequence plus 2250 bp upstream of the start codon was cloned into pLM099 by recombineering to produce a C-terminal CrVenus-3xFLAG tag. Transformed into C. reinhardtii strain CMJ030 to produce CC-5647.
Host strain: DH10B
Selection in E. coli: kanamycin
Selection in C. reinhardtii: paromomycin
https://www.biorxiv.org/content/10.1101/2020.08.16.252858v1.full
From Moritz Meyer, Martin Jonikas Lab, Princeton University, August 2020
FDX1 (Cre14.g626700) gDNA coding sequence, spanning the start codon to the triplet just before the stop codon, had been previously cloned in frame into pLM005 by Gibson assembly (as described in https://doi.org/10.1073/pnas.1522866113; CSI_FC1F06 = pLM005-Cre14.g626700-Venus-3xFLAG). That plasmid was then reengineered by restriction digestion and T4 ligation to add in-frame immediately after the 3xFLAG a synthetic fragment containing three copies of the sequence coding for the 15 C-terminal amino acids of SAGA2 (Cre 09.g394621), interspersed with a short flexible linker (GGGGGS). Transformed into C. reinhardtii strain cMJ030 with carrier DNA to produce CC-5648.
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: paromomycin
From Moritz Meyer, Martin Jonikas Lab, Princeton University, August 2020
MPM1 (Cre12.g498550) gDNA coding sequence, spanning the start codon to the triplet just before the stop codon, was cloned in frame into pLM005 by Gibson assembly (as described in https://doi.org/10.1073/pnas.1522866113. Transformed into C. reinhardtii strain cMJ030 to produce CC-5649.
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: paromomycin
From Moritz Meyer, Martin Jonikas Lab, Princeton University, August 2020
pMJ504, containing the gDNA of Cre12.g498550, was reengineered by restriction digestion and T4 ligation to add in-frame immediately after the 3xFLAG a synthetic fragment containing three copies of the sequence coding for the 15 C-terminal amino acids of SAGA2 (Cre 09.g394621), interspersed with a short flexible linker (GGGGGS). Transformed into C. reinhardtii strain cMJ030 to produce CC-5650.
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: paromomycin
From Moritz Meyer, Martin Jonikas Lab, Princeton University, August 2020
PSAK (Cre17.g724300) gDNA coding sequence, spanning the start codon to the triplet just before the stop codon, had been previously cloned in frame into pLM005 by Gibson assembly (as described in https://doi.org/10.1073/pnas.1522866113; pMJ280 = pLM005-Cre17.g724300-Venus-3xFLAG). That plasmid was then reengineered by restriction digestion and T4 ligation to add in-frame immediately after the 3xFLAG a synthetic fragment containing three copies of the sequence coding for the 15 C-terminal amino acids of SAGA2 (Cre 09.g394621), interspersed with a short flexible linker (GGGGGS). Transformed into C. reinhardtii strain cMJ030 with carrier DNA to produce CC-5651.
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: paromomycin
From Moritz Meyer, Martin Jonikas Lab, Princeton University, August 2020
Cre10.g430350 gDNA coding sequence, spanning the start codon to the triplet just before the stop codon, was cloned in frame into pLM005 by Gibson assembly (as described in https://doi.org/10.1073/pnas.1522866113). Transformed into C. reinhardtii strain cMJ030 to produce CC-5652.
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: paromomycin
From Moritz Meyer, Martin Jonikas Lab, Princeton University, August 2020
Previously synthesized pMJ507 (CC-5652) was modified by side-directed mutagenesis. Triplet coding for Tryptophan in position 51 of the mature protein now codes for an Alanine. Triplet coding for Arginine in position 52 of the mature protein now codes for an Alanine. Transformed into C. reinhardtii strain cMJ030 to produce CC-5653.
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: paromomycin
From Moritz Meyer, Martin Jonikas Lab, Princeton University, August 2020
Previously synthesized pMJ507 (CC-5652) was modified by side-directed mutagenesis. All four triplet pairs coding for a Tryptophan-Arginine dipeptide were mutagenized to code for a double Alanine (W47A/R48A/W51A/R52A/W110A/R111A/W148A/R149A). Transformed into C. reinhardtii strain cMJ030 to produce CC-5654.
Host strain: DH5α
Selection in E. coli: ampicillin
Selection in C. reinhardtii: paromomycin
From Gary Yates, Luke Mackinder lab, University of York-UK, July 2020
SAGA2 (Cre09.g394621) coding sequence plus 2216 bp upstream of the start codon was cloned into pLM099 by recombineering to produce a C-terminal CrVenus-3xFLAG tag. Transformed into C. reinhardtii strain CMJ030 to produce CC-5655.
Host strain: DH10B
Selection in E. coli: kanamycin
Selection in C. reinhardtii: paromomycin
Meyer MT, Itakura AK, Patena W, Wang L, He S, Emrich-Mills T, Lau CS, Yates G, Mackinder LCM, Jonikas MC. Assembly of the algal CO2-fixing organelle, the pyrenoid, is guided by a Rubisco-binding motif. Sci Adv. 2020 Nov 11;6(46):eabd2408. doi: 10.1126/sciadv.abd2408. PMID: 33177094; PMCID: PMC7673724.
pLM099
$30.00
$30.00
From Gary Yates, Luke Mackinder lab, University of York-UK, July 2020
Recombineering plasmid designed for generating C-terminal CrVenusYFP-3xFLAG fusion proteins. Contains the counter-selection ccdB gene that is toxic to bacteria not expressing ccdA.
The primers below can be used to amplify a cassette from the plasmid that excludes ccdB. A gene of interest can then be cloned into the cassette in-frame with CrVenusYFP-3xFLAG by recombineering.
Forward primer (5’-3’): GGAGATCTGGGTGGCTCCG
Reverse primer (5’-3’): GAAGATCCTTTGATCTTTTCTACGGG
These primer sequences should be appended to the 3’ end of gene-specific homology regions.
Host strain: DB3.1 (streptomycin resistant, ccdB resistant)
Selection in E. coli: kanamycin
Selection in C. reinhardtii: paromomycin
Emrich-Mills TZ, Yates G, Barrett J, Girr P, Grouneva I, Lau CS, Walker CE, Kwok TK, Davey JW, Johnson MP, Mackinder LCM. A recombineering pipeline to clone large and complex genes in Chlamydomonas. Plant Cell. 2021 May 31;33(4):1161-1181. doi: 10.1093/plcell/koab024. PMID: 33723601; PMCID: PMC8633747.
From Gary Yates, Luke Mackinder lab, University of York-UK, July 2020
Recombineering plasmid containing the λ phage cassette under an L-arabinose inducible promoter and the temperature-sensitive SC101 origin of replication. Should be grown at 30°C, λ phage cassette expression activated at 37°C.
Host strain: DH5α
Selection in E. coli: tetracycline
pRed (a.k.a. pLM072) was a gift to Luke Mackinder from Mihail Sarov (Max Planck Institute, Dresden, Germany), see the following publication for details: https://www.nature.com/articles/nmeth933
Emrich-Mills TZ, Yates G, Barrett J, Girr P, Grouneva I, Lau CS, Walker CE, Kwok TK, Davey JW, Johnson MP, Mackinder LCM. A recombineering pipeline to clone large and complex genes in Chlamydomonas. Plant Cell. 2021 May 31;33(4):1161-1181. doi: 10.1093/plcell/koab024. PMID: 33723601; PMCID: PMC8633747.
pLM160
$30.00
$30.00
From Gary Yates, Luke Mackinder lab, University of York-UK, July 2020
Recombineering plasmid designed for generating C-terminal mNeonGreen-3xFLAG fusion proteins.
Host strain: DB3.1 (streptomycin resistant, ccdB resistant)
Selection in E. coli: kanamycin
Selection in C. reinhardtii: paromomycin
Emrich-Mills TZ, Yates G, Barrett J, Girr P, Grouneva I, Lau CS, Walker CE, Kwok TK, Davey JW, Johnson MP, Mackinder LCM. A recombineering pipeline to clone large and complex genes in Chlamydomonas. Plant Cell. 2021 May 31;33(4):1161-1181. doi: 10.1093/plcell/koab024. PMID: 33723601; PMCID: PMC8633747.