Strains

From Martin Spalding, Iowa State University, June 2017

This starchless mutant arose from a TALEN targeted mutagenesis experiment using 21gr (CC-1690). The mutation in the STA6 gene is a single base deletion at the intron 3/exon 4 border yielding the following sequence: GATGCAGaCGGTGCT where the lowercase ‘a’ is the deleted base. To obtain a minus mating type, the initial mutant was crossed to CC-1691. A starchless mt- progeny lacking the TALEN transgene was subsequently backcrossed to 21gr (CC-1690) thirteen times. This strain is a mt+ progeny from the final cross.

  • Locus:
  • STA6 [AGP4]
  • Chromosome:
  • 3

From Martin Spalding, Iowa State University, June 2017

This strain is the original BAFJ5 sta6 starchless mutant crossed into a 21gr background.  We obtained a starchless mutant from Susan Dutcher after she successfully crossed BAFJ5 with CC-124. We then backcrossed that strain to 21gr (CC-1690) fourteen times. This is a mt- progeny from the final cross.

  • Locus:
  • STA6 [AGP4]
  • Chromosome:
  • 3

From Martin Spalding, Iowa State University, June 2017

This strain is the original BAFJ5 sta6 starchless mutant crossed into a 21gr background. We obtained a starchless mutant from Susan Dutcher after she successfully crossed BAFJ5 with CC-124. We then backcrossed that strain to 21gr (CC-1690) fourteen times. This is a mt+ progeny from the final cross.

  • Locus:
  • STA6 [AGP4]
  • Chromosome:
  • 3

From Martin Spalding, Iowa State University, June 2017

Phenotype: altered CO2 assimilation

An original pmp1 mutant, 16-5k mt-, was backcrossed to 21gr (CC-1690) thirteen times, selecting an air-dier after each cross. This strain is a mt- progeny from the final cross. This strain is an LCIB mutant that requires high CO2 concentrations for phototrophic growth.

  • Locus:
  • LCIB
  • Chromosome:
  • 10

From Martin Spalding, Iowa State University, June 2017

Phenotype: altered CO2 assimilation

An original pmp1 mutant, 16-5k mt-, was backcrossed to 21gr (CC-1690) thirteen times, selecting an air-dier after each cross. This strain is an mt+ progeny from the final cross. This strain is an LCIB mutant that requires high CO2 concentrations for phototrophic growth.

  • Locus:
  • LCIB
  • Chromosome:
  • 10

From Martin Spalding, Iowa State University, June 2017

Phenotype: altered CO2 assimilation

An original pmp1 mutant, 16-5k mt-, was backcrossed to 2137 (CC-3269) seven times, selecting an air-dier after each cross. This strain is an mt- progeny from the final cross. This strain is an LCIB mutant that requires high CO2 concentrations for phototrophic growth.

  • Locus:
  • LCIB
  • Chromosome:
  • 10

From Martin Spalding, Iowa State University, June 2017

Phenotype: altered CO2 assimilation

An original pmp1 mutant, 16-5k mt-, was backcrossed to 2137 (CC-3269) seven times, selecting an air-dier after each cross. This strain is an mt+ progeny from the final cross. This strain is an LCIB mutant that requires high CO2 concentrations for phototrophic growth.

  • Locus:
  • LCIB
  • Chromosome:
  • 10

From Martin Spalding, Iowa State University, June 2017

Phenotype: altered CO2 assimilation

This is a cross of a cia5 wall-less mutant with a pmp1 strain (lcib mutant in a 21gr background). Progeny were selected that don’t grow in low and very low CO2 concentrations. This is a mt- walled progeny. High CO2 is required to grow in full light.

  • Locus:
  • CIA5 [CCM1], LCIB
  • Chromosome:
  • 2,10

From Martin Spalding, Iowa State University, June 2017

Phenotype: altered CO2 assimilation

This is a cross of a cia5 wall-less mutant with a pmp1 strain (lcib mutant in a 21gr background). Progeny were selected that don’t grow in low or very low CO2 concentrations. This is a mt+ walled progeny. High CO2 is required to grow in full light.

  • Locus:
  • CIA5 [CCM1], LCIB
  • Chromosome:
  • 2,10

From Martin Spalding, Iowa State University, June 2017

Phenotype: altered CO2 assimilation

This is a cross of an lcid tagged strain from the Jonikas CLiP collection with a pmp1 mutant. This strain is a wall-less mt- progeny with a mutation in the LCIB gene and an insert in the LCID gene conferring it paromomycin resistance. This strain requires high CO2 concentrations for phototrophic growth.

  • Locus:
  • LCIB, LCID
  • Chromosome:
  • 10, 4

From Martin Spalding, Iowa State University, June 2017

Phenotype: altered CO2 assimilation

This is a cross of an lcid tagged strain from the Jonikas CLiP collection with a pmp1 mutant. This strain is a wall-less mt+ progeny with a mutation in the LCIB gene and an insert in the LCID gene conferring it paromomycin resistance. This strain requires high CO2 concentrations for phototrophic growth.

  • Locus:
  • LCIB, LCID
  • Chromosome:
  • 10, 4

From Martin Spalding, Iowa State University, June 2017

Phenotype: altered CO2 assimilation

This strain was identified as one that accumulates excess starch and displays robust and extended growth in bioreactors under photoautotrophic conditions supplemented with 5% CO2. It arose from a complementation of the original pmp1 mutant strain 16-5k mt-. This strain is a progeny from a cross to 21gr (CC-1690) that no longer contains the LCIB transgene but maintains the pmp1 mutation and thus

From Martin Spalding, Iowa State University, June 2017

Phenotype: excess starch

This strain was identified as one that accumulates excess starch and displays robust and extended growth in bioreactors under photoautotrophic conditions supplemented with 5% CO2. It arose from a complementation of the original pmp1 mutant strain 16-5k mt-. This strain is a progeny from a second backcross to 21gr (CC1690) that no longer contains the LCIB transgene or the pmp1 mutation. The cause of the extended growth and starch phenotypes remains unidentified.

From Martin Spalding, Iowa State University, June 2017

Phenotype: excess starch

This strain was identified as one that accumulates excess starch and displays robust and extended growth in bioreactors under photoautotrophic conditions supplemented with 5% CO2. It arose from a complementation of the original pmp1 mutant strain 16-5k mt-. This strain is a progeny from a fourth backcross to 21gr (CC1690) that no longer contains the LCIB transgene or the pmp1 mutation. The cause of the extended growth and starch phenotypes remains unidentified.

From Carolyn Silflow, University of Minnesota, July 2017

This is a rescue of the cehc1 phenotype by transformation with the wild-type gene.  Whereas the cehc1 mutant strain (CC-4508 and CC-4509) are motile due to expression of the RSP3 reporter gene, this rescue strain is immotile due to the presence of the pf14 mutation and the lack of expression of the reporter gene.

From Yuqing Hou and George Witman, University of Massachusetts Medical School, August 2017

This strain was obtained by co-transforming CC-4375 cells with linearized plasmid pSP124S (Lumbreras et al., 1998) and the truncated ift46 gene plasmid that lacks the sequence encoding amino acids 2-105.

Hou Y and Witman GB (2017) The N-terminus of IFT46 mediates intraflagellar transport of outer arm dynein and its cargo-adaptor ODA16. Mol Biol Cell 28:2420-2433

  • Locus:
  • IFT46 [FAP32]
  • Chromosome:
  • 5

From Yuqing Hou and George Witman, University of Massachusetts Medical School, August 2017

This strain was obtained by co-transforming CC-4375 cells with linearized plasmid pSP124S (Lumbreras et al., 1998) and the truncated ift46 gene plasmid that lacks the sequence encoding amino acids 2-105.

Hou Y and Witman GB (2017) The N-terminus of IFT46 mediates intraflagellar transport of outer arm dynein and its cargo-adaptor ODA16. Mol Biol Cell 28:2420-2433

  • Locus:
  • IFT46 [FAP32]
  • Chromosome:
  • 5

From Yuqing Hou and George Witman, University of Massachusetts Medical School, August 2017

This strain was obtained by co-transforming CC-4375 cells with linearized plasmid pSP124S (Lumbreras et al., 1998) and the cloned 4.8-kb fragment, which contains only the wild-type IFT46 gene.

Hou Y and Witman GB (2017) The N-terminus of IFT46 mediates intraflagellar transport of outer arm dynein and its cargo-adaptor ODA16. Mol Biol Cell 28:2420-2433

Hou Y, Qin H, Follit JA, Pazour GJ, Rosenbaum JL, Witman GB (2007) Functional analysis of an individual IFT protein: IFT46 is required for transport of outer dynein arms into flagella. J Cell Biol 176:653-65

  • Locus:
  • IFT46 [FAP32]
  • Chromosome:
  • 5

From Daniela Strenkert, Sabeeha Merchant group at UCLA, December 2017

This is a hearty wild type strain, useful for lab experiments. Like its parental strain Matagne 325 (CC-4351), it has flagella and can grow on nitrate medium. Unlike the parental strain it does not require arginine.

It was created by transforming strain CC-4351 with ARG7-expressing plasmid pCB412.

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, February 2018

This is a phototropin disruption strain, generated with CRISPR/Cas9.

Background strain              CC-125
Nuclease                                (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                    pAphVII (pPH360)
Target gene                            Phototropin, PHOT, Cre03.g199000
Target sequence                   GCGCATCCTCAACTACACCAAGG (Exon 6)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 29, Issue 10

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, February 2018

This is a phototropin disruption strain, generated with CRISPR/Cas9.

Background strain              CC-125
Nuclease                                (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                    pAphVII (pPH360)
Target gene                           Phototropin, PHOT, Cre03.g199000
Target sequence                  GCGCATCCTCAACTACACCAAGG (Exon 6)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 29, Issue 10

Deposited by Boris Zorin, Peter Hegemann lab, Humboldt University-Berlin, February 2018

This is a phototropin disruption strain, generated with single stranded DNA.

Background strain              CC-4350
Nuclease                                no
Marker                                    pAPHVIII
Target gene                           Phototropin, PHOT, Cre03.g199000

Overview of other strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This strain is no longer available. If other ∆phot strains are needed, please see the other phototropin (PHOT) disruption strains:

in CC-125:  CC-5391 ∆PHOT-C41 [PH13], CC-5392 ∆PHOT-B5 [PH15]
in SAG11-32b: CC-5429 ∆PHOT-A5 [PH135], CC-5430 ∆PHOT-A7 [PH136]

Zorin B, Lu Y, Sizova I, Hegemann P (2009) Nuclear gene targeting in Chlamydomonas as exemplified by disruption of the PHOT gene. Gene 432(1-2):91-6

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, February 2018

This is a MAT3 disruption strain, generated with CRISPR/Cas9. MAT3 shows strong homology to the animal retinoblastoma cancer gene.

Background strain              CC-125
Nuclease                                (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                    pAphVII (pPH360)
Target gene                           MAT3, Cre06.g255450
Target sequence                  GCTGAAGGAGAACTCGGAAACGG (Exon 3)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 29, Issue 10

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, February 2018

This is a MAT3 disruption strain, generated with CRISPR/Cas9. MAT3 shows strong homology to the animal retinoblastoma cancer gene.

Background strain              CC-125
Nuclease                                (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                    pAphVII (pPH360)
Target gene                           MAT3, Cre06.g255450
Target sequence                  GCTGAAGGAGAACTCGGAAACGG (Exon 3)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 29, Issue 10

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, February 2018 and Wenshuang Li, Maria Mittag lab, Friedrich Schiller University-Jena.

This is a aCRY disruption strain, generated with CRISPR/Cas9.

Note: Immunoblotting with aCRY antibody indicated small levels of aCRY protein.

Background strain              SAG 73.72 (= CC-3348)
Nuclease                                (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                    pAphVIII (pPH075)
Target gene                           aCRY, Cre06.g278251
Target sequence                  GCTGTGTTTTGAGCACGACACGG (Exon 5)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains 
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 29, Issue 10

Deposited by Simon Kelterborn, Peter Hegemann lab, Humboldt University-Berlin, February 2018 and Wenshuang Li, Maria Mittag lab, Friedrich Schiller University-Jena.

This is a aCRY disruption strain, generated with CRISPR/Cas9.

Note: Immunoblotting with aCRY antibody indicated small residual levels of aCRY protein.

Background strain              SAG 73.72 (= CC-3348)
Nuclease                                (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                    pAphVIII (pPH075)
Target gene                           aCRY, Cre06.g278251
Target sequence                  GCTGTGTTTTGAGCACGACACGG (Exon 5)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 29, Issue 10

Deposited by Simon Kelterborn and Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, February 2018

This is a chlamyopsin-1/2 (COP1/2) disruption strain, generated with CRISPR/Cas9.

Background strain              CC-125
Nuclease                                (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                    pAphVII (pPH360)
Target gene                           COP1/2, Cre01.g002500
Target sequence                  ATGGACTTCAAGAGCATCAGCGG (Exon 1)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 29, Issue 10

Deposited by Simon Kelterborn and Irina Sizova, Peter Hegemann lab, Humboldt University-Berlin, February 2018

This is a chlamyopsin-1/2 (COP1/2) disruption strain, generated with CRISPR/Cas9.

Background strain              CC-125
Nuclease                                (Sp)Cas9 as ribonucleoprotein (RNP)
Marker                                    pAphVII (pPH360)
Target gene                           COP1/2, Cre01.g002500
Target sequence                  ATGGACTTCAAGAGCATCAGCGG (Exon 1)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

Greiner A, Kelterborn S, Evers H, Kreimer G, Sizova I, Hegemann P (2017) Targeting of photoreceptor genes via zinc-finger nucleases and CRISPR/Cas9 in Chlamydomonas reinhardtii. Plant Cell 29, Issue 10

From Elizabeth Specht, Stephen Mayfield Lab, University of California-San Diego, February 2018

The B12 background strain is CC-1820 (arginine auxotroph) into which a genomic insert has been integrated (location not determined) that encodes the following: an intact ARS2 (arylsulfatase, expressed constitutively) cassette; an intact ARG7 cassette (to select transformant by restoring arginine synthesis); a ~1600bp intron; and the 3’ half of the coding sequence of the Hygromycin resistance gene, followed by a 3’ UTR. This construct is available as plasmid pHR18.

Parental strain CC-1820 was transformed with pHR18 by electroporation and colonies were obtained by selection on TAP plates without arginine added. Integration of the full 3’ end of the construct was screened by PCR, and then candidate colonies were screened by arylsulfatase assays to screen for integration of the 5’ end as well as to determine that the locus was well expressed. Strain B12 tested positive in both of these assays.

B12 grows in regular TAP media, or in HSM; it does not require supplementation as its arginine prototrophy has been restored.

This strain is designed to screen for homologous recombination (HR) by transforming it with plasmid pHR23. Upon homologous recombination of pLP23 with the pLP18 locus, the cells become resistant to hygromycin by reconstituting the hygromycin resistance cassette. A paromomycin resistance cassette in pHR23 allows for a measure of the total transformation efficiency, such that the ratio of HR to non-homologous integration can be determined from a single transformation.

  • Locus:
  • ARG7
  • Chromosome:
  • 01

From Tyler Wittkopp, Joseph Noel Lab, The Salk Institute for Biological Studies, March 2018

Wittkopp TM, Saroussi S, Yang W, Johnson X, Kim RG, Heinnickel ML, Russell JJ, Phuthong W, Dent RM, Broeckling CD, Peers G, Lohr M, Wollman FA, Niyogi KK, Grossman AR (2018) GreenCut protein CPLD49 of Chlamydomonas reinhardtii associates with thylakoid membranes and is required for cytochrome b(6) f complex accumulation. Plant J. 94:1023-1037

  • Locus:
  • CPLD49
  • Chromosome:
  • 16