Strains
CC-5656 TSP1 mt+
$30.00
$30.00
From Dr. Vinzenz Bayro-Kaiser, Tel Aviv University-Israel, August 2020
Mutant allele: Cre02.g076250.t1.1:c.2044_2045delCCinsTT
Background: 1A+ (137c) obtained from Prof. Jean-David Rochaix
Origin: UV induced mutagenesis followed by 5 times backcrossing to the background strain and selection
Culture maintenance: TAP media, 25 °C, 100 uEm-2s-1
Bayro-Kaiser V, Nelson N (2016)Temperature-sensitive PSII: a novel approach for sustained photosynthetic hydrogen production. Photosynth Res. 130:113-121
Bayro-Kaiser V, Nelson N (2020) Temperature Sensitive Photosynthesis: Point Mutated CEF-G, PRK, or PsbO Act as Temperature-Controlled Switches for Essential Photosynthetic Processes. Frontiers in Plant Science 11:1465
CC-5657 TSP2 mt+
$30.00
$30.00
From Dr. Vinzenz Bayro-Kaiser, Tel Aviv University-Israel, August 2020
Mutant allele: Cre12.g554800.t1.2:c.479C>T
Background: 1A+ (137c) obtained from Prof. Jean-David Rochaix
Origin: UV induced mutagenesis followed by 5 times backcrossing to the background strain and selection
Culture maintenance: TAP media, 25 °C, 100 uEm-2s-1
Bayro-Kaiser V, Nelson N (2016)Temperature-sensitive PSII: a novel approach for sustained photosynthetic hydrogen production. Photosynth Res. 130:113-121
Bayro-Kaiser V, Nelson N (2020) Temperature Sensitive Photosynthesis: Point Mutated CEF-G, PRK, or PsbO Act as Temperature-Controlled Switches for Essential Photosynthetic Processes. Frontiers in Plant Science 11:1465
CC-5658 TSP3 mt+
$30.00
$30.00
From Dr. Vinzenz Bayro-Kaiser, Tel Aviv University-Israel, August 2020
Mutant alleles: Cre10.g448950.t1.1:c.71_72delCTinsTCÂ Â &Â Â Cre10.g448950.t1.1:c.101T>CÂ Â &Â Â Cre10.g449600.t1.1:c.365G>A
Background: 1A+ (137c) obtained from Prof. Jean-David Rochaix
Origin: UV induced mutagenesis followed by 5 times backcrossing to the background strain and selection
Culture maintenance: TAP media, 25 °C, 100 uEm-2s-1
Bayro-Kaiser V, Nelson N (2016)Temperature-sensitive PSII: a novel approach for sustained photosynthetic hydrogen production. Photosynth Res. 130:113-121
Bayro-Kaiser V, Nelson N (2020) Temperature Sensitive Photosynthesis: Point Mutated CEF-G, PRK, or PsbO Act as Temperature-Controlled Switches for Essential Photosynthetic Processes. Frontiers in Plant Science 11:1465
CC-5659 TSP4 mt+
$30.00
$30.00
From Dr. Vinzenz Bayro-Kaiser, Tel Aviv University-Israel, August 2020
Mutant allele: Cre09.g396213.t1.1:c.302C>A
Background: 1A+ (137c) obtained from Prof. Jean-David Rochaix
Origin: UV induced mutagenesis followed by 5 times backcrossing to the background strain and selection
Culture maintenance: TAP media, 25 °C, 100 uEm-2s-1
Bayro-Kaiser V, Nelson N (2016)Temperature-sensitive PSII: a novel approach for sustained photosynthetic hydrogen production. Photosynth Res. 130:113-121
Bayro-Kaiser V, Nelson N (2020) Temperature Sensitive Photosynthesis: Point Mutated CEF-G, PRK, or PsbO Act as Temperature-Controlled Switches for Essential Photosynthetic Processes. Frontiers in Plant Science 11:1465
CC-5660 l1b-2 mt+
$30.00
$30.00
From Alfredo Kono, Martin Spalding lab, Iowa State University, July 2020
This double mutant is a product of a cross of LMJ.RY0402.191570 mt- (LCI1 mutant) with pmp1 CCâ€5378 mt+ (LCIB mutant) and requires high CO2 concentrations for phototrophic growth.
Mutant alleles: LCIB, Cre10.g452800.t1.1, chromosome_10:4608866..4611901 forward; LCI1, Cre03.g162800.t1.1, chromosome_3:2885264..2887871 reverse
Kono A, Spalding MH. LCI1, a Chlamydomonas reinhardtii plasma membrane protein, functions in active CO2 uptake under low CO2. Plant J. 2020 Jun;102(6):1127-1141. doi: 10.1111/tpj.14761. Epub 2020 Apr 27. PMID: 32248584.
Li X, Zhang R, Patena W, Gang SS, Blum SR, Ivanova N, Yue R, Robertson JM, Lefebvre PA, Fitz-Gibbon ST, Grossman AR, Jonikas MC. An Indexed, Mapped Mutant Library Enables Reverse Genetics Studies of Biological Processes in Chlamydomonas reinhardtii. Plant Cell. 2016 Feb;28(2):367-87. doi: 10.1105/tpc.15.00465. Epub 2016 Jan 13. PMID: 26764374; PMCID: PMC4790863.
CC-5661 l1a-2 mt-
$30.00
$30.00
From Alfredo Kono, Martin Spalding lab, Iowa State University, July 2020
This double mutant is the product of a cross of LMJ.RY0402.191570 mt- (LCI1 mutant) with lcia63 mt+ CCâ€5066 (LCIA mutant).
Mutant alleles: LCIA, NAR 1.2, Cre06.g309000.t1.1, chromosome_6:8604782..8607670 reverse; LCI1, Cre03.g162800.t1.1, chromosome_3:2885264..2887871 reverse
Kono A, Spalding MH. LCI1, a Chlamydomonas reinhardtii plasma membrane protein, functions in active CO2 uptake under low CO2. Plant J. 2020 Jun;102(6):1127-1141. doi: 10.1111/tpj.14761. Epub 2020 Apr 27. PMID: 32248584.
Li X, Zhang R, Patena W, Gang SS, Blum SR, Ivanova N, Yue R, Robertson JM, Lefebvre PA, Fitz-Gibbon ST, Grossman AR, Jonikas MC. An Indexed, Mapped Mutant Library Enables Reverse Genetics Studies of Biological Processes in Chlamydomonas reinhardtii. Plant Cell. 2016 Feb;28(2):367-87. doi: 10.1105/tpc.15.00465. Epub 2016 Jan 13. PMID: 26764374; PMCID: PMC4790863.
Wang Y, Spalding MH. Acclimation to very low CO2: contribution of limiting CO2 inducible proteins, LCIB and LCIA, to inorganic carbon uptake in Chlamydomonas reinhardtii. Plant Physiol. 2014 Dec;166(4):2040-50. doi: 10.1104/pp.114.248294. Epub 2014 Oct 21. PMID: 25336519; PMCID: PMC4256846.
CC-5662 labE mt+
$30.00
$30.00
From Alfredo Kono, Martin Spalding lab, Iowa State University, July 2020
This double mutant is the product of lcia90 mt+ (CCâ€5067, LCIA mutant) backcrossed five times with pmp1 21gr mt- (CCâ€5375, LCIB mutant) and requires high CO2 concentrations for phototrophic growth.
Mutant alleles: LCIB, Cre10.g452800.t1.1, chromosome_10:4608866..4611901 forward; LCIA, NAR 1.2, Cre06.g309000.t1.1, chromosome_6:8604782..8607670 reverse
Kono A, Spalding MH. LCI1, a Chlamydomonas reinhardtii plasma membrane protein, functions in active CO2 uptake under low CO2. Plant J. 2020 Jun;102(6):1127-1141. doi: 10.1111/tpj.14761. Epub 2020 Apr 27. PMID: 32248584.
Wang Y, Spalding MH. Acclimation to very low CO2: contribution of limiting CO2 inducible proteins, LCIB and LCIA, to inorganic carbon uptake in Chlamydomonas reinhardtii. Plant Physiol. 2014 Dec;166(4):2040-50. doi: 10.1104/pp.114.248294. Epub 2014 Oct 21. PMID: 25336519; PMCID: PMC4256846.
From George B. Witman, University of Massachusetts Medical School, August 2020
This is a double mutant made by mating ift74-2 IFT74Δ130 (Brown et al., 2015) to ift81-1 IFT81(5E) (Kubo et al., 2016). The strain expresses both IFT74Δ130 and IFT81(5E) in a background otherwise null for IFT74 and IFT81. IFT74Δ130 is a version of IFT74 lacking aa 1-130 important for the protein’s interaction with the highly acidic tail (also known as E-hook) of β-tubulin. IFT81(5E) is a version of IFT81 in which five highly conserved basic residues (K73, R75, R87, K114, and R115) in the protein’s calponin-homology domain have been replaced by glutamate to reduce or eliminate the protein’s binding to tubulin. The strain is predicted to lack nearly all intraflagellar transport of tubulin. It has a strong palmelloid phenotype and forms very short flagella with normal axonemal ultrastructure.
It was created by insertional mutagenesis of the parent strains with a fragment conferring resistance to hygromycin B (aph7â€) to generate ift74-2 and ift81-1, followed by transformation with a DNA fragment encoding IFT74Δ130 or IFT81(5E), respectively, and containing a paromomycin-resistance gene as a selectable marker. The transformed strains were then crossed to generate the double mutant.
Mutant alleles: ift74-2, chromosome_1:4204163-4208957; ift81-1, chromosome_17:3362408-3368081
Brown JM, Cochran DA, Craige B, Kubo T, Witman GB. Assembly of IFT trains at the ciliary base depends on IFT74. Curr Biol. 2015 Jun 15;25(12):1583-93. doi: 10.1016/j.cub.2015.04.060. Epub 2015 Jun 4. PMID: 26051893; PMCID: PMC4482480.
Kubo T, Brown JM, Bellve K, Craige B, Craft JM, Fogarty K, Lechtreck KF, Witman GB. Together, the IFT81 and IFT74 N-termini form the main module for intraflagellar transport of tubulin. J Cell Sci. 2016 May 15;129(10):2106-19. doi: 10.1242/jcs.187120. Epub 2016 Apr 11. PMID: 27068536; PMCID: PMC5506485.
Van De Weghe JC, Harris JA, Kubo T, Witman GB, Lechtreck KF. Diffusion rather than IFT likely provides most of the tubulin required for axonemal assembly. J Cell Sci. 2020 Aug 14:jcs.249805. doi: 10.1242/jcs.249805. Epub ahead of print. PMID: 32801124.
CC-5664 ift81-1 IFT81HA mt+
$30.00
$30.00
From George B. Witman, University of Massachusetts Medical School, August 2020
In this strain, IFT81-HA is incorporated into the IFT-B complex and localizes normally in cell bodies and flagella. The cells appear to be fully rescued for motility and flagellar length.
It was created by insertional mutagenesis of the parent strain with a fragment conferring resistance to hygromycin B (aph7â€) to generate the null mutant ift81-1, followed by rescue with a DNA fragment encoding IFT81 with a 3xhemagglutinin (HA) tag at its C-terminal end and containing a paromomycin-resistance gene as a selectable marker.
Mutant allele: ift81-1, chromosome_17:3362408-3368081
Kubo T, Brown JM, Bellve K, Craige B, Craft JM, Fogarty K, Lechtreck KF, Witman GB. Together, the IFT81 and IFT74 N-termini form the main module for intraflagellar transport of tubulin. J Cell Sci. 2016 May 15;129(10):2106-19. doi: 10.1242/jcs.187120. Epub 2016 Apr 11. PMID: 27068536; PMCID: PMC5506485.
From George B. Witman, University of Massachusetts Medical School, August 2020
This strain expresses IFT81(2E) in a background null for IFT81. IFT81(2E) is a version of IFT81 in which two highly conserved basic residues (K73 and R75) in the protein’s calponin-homology domain, implicated in binding to tubulin, have been replaced by glutamate. The strain has apparently normal length flagella, normal flagellar regeneration kinetics, normal motility, and normal IFT. The frequency of anterograde tubulin IFT was not significantly reduced in the flagella of this strain.
It was created by insertional mutagenesis of the parent strain with a fragment conferring resistance to hygromycin B (aph7â€) to generate ift81-1, followed by transformation with a DNA fragment encoding IFT81(2E) and containing a paromomycin-resistance gene as a selectable marker.
Mutant allele: ift81-1, chromosome_17:3362408-3368081
Kubo T, Brown JM, Bellve K, Craige B, Craft JM, Fogarty K, Lechtreck KF, Witman GB. Together, the IFT81 and IFT74 N-termini form the main module for intraflagellar transport of tubulin. J Cell Sci. 2016 May 15;129(10):2106-19. doi: 10.1242/jcs.187120. Epub 2016 Apr 11. PMID: 27068536; PMCID: PMC5506485.
Deposited by Simon Kelterborn and Philipp Sachse, Peter Hegemann lab, Humboldt University of Berlin, November 2020
This is a pCRY disruption in a ROC15-Luc+ reporter strain, generated with CRISPR/Cas9. Clone D5
Background strain: ROC15-Luc+ (from Takuya Matsuo, see Niwa et al. 2013 for details)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: pCRY, (Cre06.g295200)
Target sequence: GCGACATGCTGTATGAGCCG TGG (exon 2)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Simon Kelterborn and Philipp Sachse, Peter Hegemann lab, Humboldt University of Berlin, November 2020
This is a pCRY disruption in a ROC15-Luc+ reporter strain, generated with CRISPR/Cas9. Clone C64
Background strain: ROC15-Luc+ (from Takuya Matsuo, see Niwa et al. 2013 for details)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: pCRY, (Cre06.g295200)
Target sequence: GCGACATGCTGTATGAGCCG TGG (exon 2)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5674 ∆SNRK2.2-D12 [PH184]
$30.00
$30.00
Deposited by Simon Kelterborn and Francisca Boehning, Peter Hegemann lab, Humboldt University of Berlin, November 2020
This is a SNRK2.2 (SAC3) disruption strain, generated with CRISPR/Cas9. Clone D12.
Mutants with a disrupted SNRK2.2 (SAC3) gene show constitutive arylsulfatase expression and can phenotypically screened with X-SO4 dyes (see Davies et al. 1992).
Background strain: CC-125
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: SNRK2.2, Cre12.g499500
Target sequence: TAGCGAGGATGTCCAATCAG GGG (exon 1)
Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5675 ∆ChR1 [PH209]
$30.00
$30.00
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2021
This is a ChR1 disruption strain, generated with CRISPR/Cas9.
Background strain: CC-124 mt-
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Target gene: ChR1, Cre14.g611300
Target sequence: TGTGGCTTCGTTACGCGGAG
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5676 ∆pCry-EMX-D4 [PH231]
$30.00
$30.00
Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, May 2021
This is a pCry disruption strain, generated with CRISPR/Cas9.
Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: pCry, Cre06.g295200
Target sequence: GACCTAGAGTGTGATGCGCT
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5677 ∆pCry-EMX-D7 [PH232]
$30.00
$30.00
Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, May 2021
This is a pCry disruption strain, generated with CRISPR/Cas9.
Background strain: CC-125 mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: pCry, Cre06.g295200
Target sequence: GACCTAGAGTGTGATGCGCT
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5678 ∆ChR2-H12 [PH164]
$30.00
$30.00
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2021
This is a ChR2 disruption strain, generated with CRISPR/Cas9.
Background strain: SAG 11-32b mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: ChR2, Cre02.g085257
Target sequence: AGTGGTTGCGTTACGCCGAG
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2021
This is a ChR1ChR2 disruption strain, generated with CRISPR/Cas9.
Background strain: SAG 11-32b mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300
ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG
AGTGGTTGCGTTACGCCGAG
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2021
This is a ChR1ChR2 disruption strain, generated with CRISPR/Cas9.
Background strain: SAG 11-32b mt+
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300
ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG
AGTGGTTGCGTTACGCCGAG
Visit www.chlamy.de for more info or contact CRISPR@chlamy.de
This is an unpublished strain. Please contact ph@chlamy.de before using it.
CC-5681 stt7-1 mt- [A20]
$30.00
$30.00
From Sandrine Bujaldon, Institut de Biologie Physico-Chimique, June 2021
The stt7 mutant is defective in state transition between photosystem I and photosystem II. It was scored in 2021 and is completely deficient in state transition. It should be noted that this strain cannot mate and is suspected to be a diploid (Sandrine Bujaldon, June 2021, personal communication). This strain is a replacement for CC-4178 that lost the original phenotype.
Fleischmann MM, Ravanel S, Delosme R, Olive J, Zito F, Wollman FA, Rochaix JD. Isolation and characterization of photoautotrophic mutants of Chlamydomonas reinhardtii deficient in state transition. J Biol Chem. 1999 Oct 22;274(43):30987-94. doi: 10.1074/jbc.274.43.30987. PMID: 10521495.
Finazzi G, Rappaport F, Furia A, Fleischmann M, Rochaix JD, Zito F, Forti G. Involvement of state transitions in the switch between linear and cyclic electron flow in Chlamydomonas reinhardtii. EMBO Rep. 2002 Mar;3(3):280-5. doi: 10.1093/embo-reports/kvf047. Epub 2002 Feb 15. PMID: 11850400; PMCID: PMC1084013.
CC-5682 stt7-9 mt+
$30.00
$30.00
From Sandrine Bujaldon, Institut de Biologie Physico-Chimique, June 2021
This strain can be crossed and is a leaky stt7 mutant (checked by fluorescence in oxic conditions versus anoxic by Sandrine Bujaldon in 2021).
Fleischmann MM, Ravanel S, Delosme R, Olive J, Zito F, Wollman FA, Rochaix JD. Isolation and characterization of photoautotrophic mutants of Chlamydomonas reinhardtii deficient in state transition. J Biol Chem. 1999 Oct 22;274(43):30987-94. doi: 10.1074/jbc.274.43.30987. PMID: 10521495.
Finazzi G, Rappaport F, Furia A, Fleischmann M, Rochaix JD, Zito F, Forti G. Involvement of state transitions in the switch between linear and cyclic electron flow in Chlamydomonas reinhardtii. EMBO Rep. 2002 Mar;3(3):280-5. doi: 10.1093/embo-reports/kvf047. Epub 2002 Feb 15. PMID: 11850400; PMCID: PMC1084013.
Cardol P, Alric J, Girard-Bascou J, Franck F, Wollman FA, Finazzi G. Impaired respiration discloses the physiological significance of state transitions in Chlamydomonas. Proc Natl Acad Sci U S A. 2009 Sep 15;106(37):15979-84. doi: 10.1073/pnas.0908111106. Epub 2009 Sep 1. Erratum in: Proc Natl Acad Sci U S A. 2019 Apr 2;116(14):7150. PMID: 19805237; PMCID: PMC2747229.
Bergner SV, Scholz M, Trompelt K, Barth J, Gäbelein P, Steinbeck J, Xue H, Clowez S, Fucile G, Goldschmidt-Clermont M, Fufezan C, Hippler M. STATE TRANSITION7-Dependent Phosphorylation Is Modulated by Changing Environmental Conditions, and Its Absence Triggers Remodeling of Photosynthetic Protein Complexes. Plant Physiol. 2015 Jun;168(2):615-34. doi: 10.1104/pp.15.00072. Epub 2015 Apr 9. PMID: 25858915; PMCID: PMC4453777.
CC-5683 npq4; stt7-9 mt-
$30.00
$30.00
From Sandrine Bujaldon, Institut de Biologie Physico-Chimique, June 2021
Allorent G, Tokutsu R, Roach T, Peers G, Cardol P, Girard-Bascou J, Seigneurin-Berny D, Petroutsos D, Kuntz M, Breyton C, Franck F, Wollman FA, Niyogi KK, Krieger-Liszkay A, Minagawa J, Finazzi G. A dual strategy to cope with high light in Chlamydomonas reinhardtii. Plant Cell. 2013 Feb;25(2):545-57. doi: 10.1105/tpc.112.108274. Epub 2013 Feb 19. PMID: 23424243; PMCID: PMC3608777.
CC-5688 tetex2b [23.21]
$30.00
$30.00
CC-5689 fap70-1 mt+
$30.00
$30.00
CC-5691 B4 CEP290-HA rescue
$30.00
$30.00
- «Previous Page
- 1
- …
- 114
- 115
- 116
- 117
- 118
- …
- 131
- Next Page»