Strains Archives - Page 120 of 129 - Chlamydomonas Resource Center

* The listed price of $30.00 for cultures and plasmids is for academic and non-profit users. Commercial and industrial users are charged $300.00 for each strain or plasmid and twice the listed price for media components. BACs and fosmids are $50.00 for academic and non-profit users and $500 for commercial/industry. For the Jonikas CLiP mutants, the price is $100.00 each for academic and non-profit users and commercial and industrial users are charged $1000.00. Subscriptions cannot be used for CLiP mutants, BACs nor fosmids.

CC-5783 nri1 mt-

$30.00

From Jacob Munz, Moyan Jia, Sunjoo Joo, and Jae-Hyeok Lee, University of British Columbia, December 2021

Jia, M., Munz, J., Lee, J., Shelley, N., Xiong, Y., Joo, S., Jin, ES., and Lee, J.-H. (2022) The bHLH family NITROGEN-REPLETION INSENSITIVE1 represses nitrogen starvation-induced responses in Chlamydomonas reinhardtii.

CC-5784 nri1 mt-, complemented

$30.00

From Jacob Munz, Moyan Jia, Sunjoo Joo, and Jae-Hyeok Lee, University of British Columbia, December 2021

CC-5785 5-855 mt-

$30.00

From Jacob Munz, Moyan Jia, Sunjoo Joo, and Jae-Hyeok Lee, University of British Columbia, December 2021

CC-5786 ∆KU80-C6 mt+ [PH151]

$30.00

From Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2021

This is a KU80 disruption strain, generated with SpCas9 based on the CC-125 strain.

Background strain: CC-125 mt+
Nuclease: SpCas9
Target gene: KU80 Cre10.g423800
Target sequence: CTCAGTGCCGTACAGCACCA
Marker: pAphVII (pPH360)

This strain was published in Sizova et al https://doi.org/10.1093/g3journal/jkab114.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains

Sizova I, Kelterborn S, Verbenko V, Kateriya S, Hegemann P. Chlamydomonas POLQ is necessary for CRISPR/Cas9-mediated gene targeting. G3 (Bethesda). 2021 Apr 9;11(7):jkab114. doi: 10.1093/g3journal/jkab114. Epub ahead of print. PMID: 33836052; PMCID: PMC8495919.

CC-5787 ∆POLQ-E2 mt+ [PH152]

$30.00

Deposited by Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin,
December 2021

This is a POLQ disruption strain, generated with SpCas9 based on ChR1 disruption strain in CC-3403 [PH55].

Background strain: CC-3403, ChR1 disruption strain [PH55]
Nuclease: SpCas9
Target gene: POLQ Cre16.g664300
Target sequence: GCATCAGTTGATGGTGACGG
Marker: pAphVII (pPH360)
pBle

This strain was published in Sizova et al https://doi.org/10.1093/g3journal/jkab114.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

CC-5791 ∆KU80-C4 mt+ [PH150]

$30.00

From Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2021

This is a KU80 disruption strain, generated with SpCas9 based on the CC125 strain.

Background strain: CC-125 mt+
Nuclease: SpCas9
Target gene: KU80 Cre10.g423800
Target sequence: CTCAGTGCCGTACAGCACCA
Marker: pAphVII (pPH360)

This strain was published in Sizova et al https://doi.org/10.1093/g3journal/jkab114.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

CC-5792 ∆POLQ-G2 mt+ [PH019]

$30.00

From Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2021

This is a POLQ disruption strain, generated with SpCas9 based on the CC125 strain.

Background strain: CC-125 mt+
Nuclease: SpCas9
Target gene: POLQ Cre16.g664300
Target sequence: GCCGCGCCATCCACATTGCT
Marker: pAphVII (pPH360)

This strain was published in Sizova et al https://doi.org/10.1093/g3journal/jkab114.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

CC-5793 ∆KU70-C8 mt+ [PH148]

$30.00

From Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2021

This is a ∆KU70 disruption strain, generated with SpCas9 based on the CC125 strain.

Background strain: CC-125 mt+
Nuclease: SpCas9
Target gene: KU70 Cre13.g607500
Target sequence: GTCGTTTGAGAACACCACAA
Marker: pAphVII (pPH360)

This strain was published in Sizova et al https://doi.org/10.1093/g3journal/jkab114.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

CC-5794 ∆KU70-D10 mt+ [PH149]

$30.00

From Irina Sizova, Peter Hegemann lab, Humboldt University of Berlin, December 2021

This is a ∆KU70 disruption strain, generated with SpCas9 based on the CC125 strain.

Background strain: CC-125 mt+
Nuclease: SpCas9
Target gene: KU70 Cre13.g607500
Target sequence: GTCGTTTGAGAACACCACAA
Marker: pAphVII (pPH360)

This strain was published in Sizova et al https://doi.org/10.1093/g3journal/jkab114.
Overview of all strains from the Hegemann lab http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

CC-5795 sak1 mt+

$30.00

From Setsuka Wakoa, Niyogi lab, University of California-Berkeley, January 2022

Insertion of zeocin resistance at Chr17, Cre17.g741300 and back-crossed 5 times.

Ledford HK, Chin BL, Niyogi KK. Acclimation to singlet oxygen stress in Chlamydomonas reinhardtii. Eukaryot Cell. 2007 Jun;6(6):919-30. doi: 10.1128/EC.00207-06. Epub 2007 Apr 13. PMID: 17435007; PMCID: PMC1951523.

Wakao S, Chin BL, Ledford HK, Dent RM, Casero D, Pellegrini M, Merchant SS, Niyogi KK. Phosphoprotein SAK1 is a regulator of acclimation to singlet oxygen in Chlamydomonas reinhardtii. Elife. 2014 May 23;3:e02286. doi: 10.7554/eLife.02286. PMID: 24859755; PMCID: PMC4067076.

CC-5796 D4cia5/GYD mt-

$30.00

From Antonia Schad, University of Leipzig, January 2022

This strain was obtained from a conventional crossing using two mutants: LMJ.SG0182.017965 (deficient in the gene for glycolate dehydrogenase) and CC-2702 cia5 (deficient in carbon concentrating mechanisms). Prior to this, both mutant strains were crossed with wild type strains to improve fitness: LMJ.SG0182.017965 x SAG 11-32b and CC-2702 cia5 x CC-410.

D4cia5/GYD is a double mutant deficient in the genes for cia5/CCM1 and GYD1. Cia5 has previously been identified as master regulator of the carbon concentrating mechanism in Chlamydomonas (Fukuzawa et al, 2001; Xiang et al, 2001). GYD1 is the glycolate dehydrogenase that converts glycolate from photorespiration into glyoxylate. The strain requires elevated CO₂ for growth on minimal medium due to its photorespiratory phenotype. It grows well on acetate medium. Since it contains a paromomycin resistance cassette, it can also be cultured on medium with antibiotic (Zhang et al., 2014).

Schad A, Rössler S, Nagel R, Wagner H, Wilhelm C. Crossing and selection of Chlamydomonas reinhardtii strains for biotechnological glycolate production. Appl Microbiol Biotechnol. 2022 May 5. doi: 10.1007/s00253-022-11933-y. Epub ahead of print. PMID: 35511277.

Locus:
CIA5 [CCM1], GYD1
Chromosome:
2, 6

CC-5797 D5cia5/GYD mt+

$30.00

From Antonia Schad, University of Leipzig, January 2022

D5cia5/GYD is a double mutant deficient in the genes for cia5/CCM1 and GYD1. Cia5 has previously been identified as master regulator of the carbon concentrating mechanism in Chlamydomonas (Fukuzawa et al, 2001; Xiang et al, 2001). GYD1 is the glycolate dehydrogenase that converts glycolate from photorespiration into glyoxylate. The strain requires elevated CO₂ for growth on minimal medium due to its photorespiratory phenotype. It grows well on acetate medium. Since it contains a paromomycin resistance cassette, it can also be cultured on medium with antibiotic (Zhang et al., 2014).

Locus:
CIA5 [CCM1], GYD1
Chromosome:
2, 6