Strains

From Adrian Nievergelt, Max-Planck-Institute for Molecular Cell Biology and Genetics (MPI-CBG), Dresden, Germany, August 2023

Background: CC-124 32M

Origin: CRISPR mediated endogenous n-terminal mNeonGreen with introns + c-terminal mScarlet-I knock-in

Proof of concept strain for serially tagging the same gene on both termini. IFT content in this strain is reduced in quantity but present. Resistant to Paromomycin and Blasticidin S.

Nievergelt AP, Diener DR, Bogdanova A, Brown T, Pigino G. Efficient precision editing of endogenous Chlamydomonas reinhardtii genes with CRISPR-Cas. Cell Rep Methods. 2023 Aug 22;3(8):100562. doi: 10.1016/j.crmeth.2023.100562. PMID: 37671018; PMCID: PMC10475843.

  • Locus:
  • FT46 (Cre05.g241637_4532)
  • Chromosome:
  • 5

From Adrian Nievergelt, Max-Planck-Institute for Molecular Cell Biology and Genetics (MPI-CBG), Dresden, Germany, August 2023

Background: CC-124 32M

Origin: Co-targeted CRISPR mediated endogenous c-terminal mScarletI + DRC4::AphVIII insertion

Proof of concept strain for cotargeted genome editing with the possibility of crossing out the resistance marker in a second step. See CC-6015 for crossed out non-resistance IFT46-mScarletI progeny. Resistant to Paromomycin.

Nievergelt AP, Diener DR, Bogdanova A, Brown T, Pigino G. Efficient precision editing of endogenous Chlamydomonas reinhardtii genes with CRISPR-Cas. Cell Rep Methods. 2023 Aug 22;3(8):100562. doi: 10.1016/j.crmeth.2023.100562. PMID: 37671018; PMCID: PMC10475843.

  • Locus:
  • IFT46 (Cre05.g241637_4532), DRC4 (Cre05.g241637_4532)
  • Chromosome:
  • 5, 5

From Adrian Nievergelt, Max-Planck-Institute for Molecular Cell Biology and Genetics (MPI-CBG), Dresden, Germany, August 2023

Background: CC-124/CC-125

Origin: Back-cross of CC-6014 to CC-125 to restore wild-type DRC4 function and remove the AphVIII resistance marker previously used for selection

Proof of concept strain for cotargeted genome editing with the possibility of crossing out the resistance marker. See CC-6014 for original CRISPR strain with disrupted DRC4 gene. No antibiotic resistance present.

Nievergelt AP, Diener DR, Bogdanova A, Brown T, Pigino G. Efficient precision editing of endogenous Chlamydomonas reinhardtii genes with CRISPR-Cas. Cell Rep Methods. 2023 Aug 22;3(8):100562. doi: 10.1016/j.crmeth.2023.100562. PMID: 37671018; PMCID: PMC10475843.

  • Locus:
  • IFT46 (Cre05.g241637_4532)
  • Chromosome:
  • 5

From Adrian Nievergelt, Max-Planck-Institute for Molecular Cell Biology and Genetics (MPI-CBG), Dresden, Germany, August 2023

Background: CC-124 32M

Origin: Co-targeted CRISPR mediated endogenous n-terminal mNeonGreen with introns + DRC4::AphVIII insertion

Proof of concept strain for cotargeted genome editing with region replacement by multiple guide RNAs. The expression of fluorescent tubulin is visible in a confocal microscope, but very expression is unusually low. Resistant to Paromomycin.

Nievergelt AP, Diener DR, Bogdanova A, Brown T, Pigino G. Efficient precision editing of endogenous Chlamydomonas reinhardtii genes with CRISPR-Cas. Cell Rep Methods. 2023 Aug 22;3(8):100562. doi: 10.1016/j.crmeth.2023.100562. PMID: 37671018; PMCID: PMC10475843.

  • Locus:
  • alpha tubulin, TUA1 (Cre03.g190950_4532)
  • Chromosome:
  • 3

From Adrian Nievergelt, Max-Planck-Institute for Molecular Cell Biology and Genetics (MPI-CBG), Dresden, Germany, August 2023

Background: CC-124 32M

Origin: CRISPR mediated endogenous c-terminal mNeonGreen fusion

This strain has bright fluorescent ciliary tips as well as zones of fluorescence clost to the ciliary base. Resistant to Nourseothricin.

Nievergelt AP, Diener DR, Bogdanova A, Brown T, Pigino G. Efficient precision editing of endogenous Chlamydomonas reinhardtii genes with CRISPR-Cas. Cell Rep Methods. 2023 Aug 22;3(8):100562. doi: 10.1016/j.crmeth.2023.100562. PMID: 37671018; PMCID: PMC10475843.

  • Locus:
  • FAP256 (Cre10.g431150_4532)
  • Chromosome:
  • 10

From Adrian Nievergelt, Max-Planck-Institute for Molecular Cell Biology and Genetics (MPI-CBG), Dresden, Germany, August 2023

Background: CC-4375

Origin: Insertional rescue of IFT46::NIT

Red fluorescent label for IFT, but less bright than CC-6014/CC-6015. Resistant to Paromomycin.

Nievergelt AP, Diener DR, Bogdanova A, Brown T, Pigino G. Efficient precision editing of endogenous Chlamydomonas reinhardtii genes with CRISPR-Cas. Cell Rep Methods. 2023 Aug 22;3(8):100562. doi: 10.1016/j.crmeth.2023.100562. PMID: 37671018; PMCID: PMC10475843.

  • Locus:
  • IFT46 (Cre05.g241637_4532)
  • Chromosome:
  • 5

From Adrian Nievergelt, Max-Planck-Institute for Molecular Cell Biology and Genetics (MPI-CBG), Dresden, Germany, August 2023

Background: CC-124 32M/CC-4375

Origin: Cross between CC-6017 and CC-6018

This strain has bright green fluorescent ciliary tips as well as zones of green fluorescence clost to the ciliary base and red fluorescent IFT. Resistant to Nourseothricin and Paromomycin.

Nievergelt AP, Diener DR, Bogdanova A, Brown T, Pigino G. Efficient precision editing of endogenous Chlamydomonas reinhardtii genes with CRISPR-Cas. Cell Rep Methods. 2023 Aug 22;3(8):100562. doi: 10.1016/j.crmeth.2023.100562. PMID: 37671018; PMCID: PMC10475843.

  • Locus:
  • FAP256 (Cre10.g431150_4532), IFT46 (Cre05.g241637_4532
  • Chromosome:
  • 10, 5

From Lea Alford, Oglethorpe University, August 2023

Hwang J, Yanagisawa H, Davis KC, Hunter EL, Fox LA, Jimenez AR, Goodwin RE, Gordon SA, Stuart CDE, Bower R, Porter ME, Dutcher SK, Sale WS, Lechtreck KF, Alford LM. Assembly of FAP93 at the proximal axoneme in Chlamydomonas cilia. Cytoskeleton (Hoboken). 2024 Jan 15. doi: 10.1002/cm.21818. Epub ahead of print. PMID: 38224153.

From Lea Alford, Oglethorpe University, August 2023

Hwang J, Yanagisawa H, Davis KC, Hunter EL, Fox LA, Jimenez AR, Goodwin RE, Gordon SA, Stuart CDE, Bower R, Porter ME, Dutcher SK, Sale WS, Lechtreck KF, Alford LM. Assembly of FAP93 at the proximal axoneme in Chlamydomonas cilia. Cytoskeleton (Hoboken). 2024 Jan 15. doi: 10.1002/cm.21818. Epub ahead of print. PMID: 38224153.

From Lea Alford, Oglethorpe University, August 2023

Hwang J, Yanagisawa H, Davis KC, Hunter EL, Fox LA, Jimenez AR, Goodwin RE, Gordon SA, Stuart CDE, Bower R, Porter ME, Dutcher SK, Sale WS, Lechtreck KF, Alford LM. Assembly of FAP93 at the proximal axoneme in Chlamydomonas cilia. Cytoskeleton (Hoboken). 2024 Jan 15. doi: 10.1002/cm.21818. Epub ahead of print. PMID: 38224153.

From Lea Alford, Oglethorpe University, August 2023

Hwang J, Yanagisawa H, Davis KC, Hunter EL, Fox LA, Jimenez AR, Goodwin RE, Gordon SA, Stuart CDE, Bower R, Porter ME, Dutcher SK, Sale WS, Lechtreck KF, Alford LM. Assembly of FAP93 at the proximal axoneme in Chlamydomonas cilia. Cytoskeleton (Hoboken). 2024 Jan 15. doi: 10.1002/cm.21818. Epub ahead of print. PMID: 38224153.

From Chun Sing Lau, Mackinder lab, University of York, July 2023

This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of RBCS2 (Cre02.g120150) as a fusion protein with a C-terminal TurboID and 3xHA tag using the PSAD promoter/terminator pair. The strain carries resistance to hygromycin.

Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.

From Chun Sing Lau, Mackinder lab, University of York, July 2023

This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of RPE1 (Cre12.g511900) as a fusion protein with a C-terminal TurboID and 3xHA tag using the PSAD promoter/terminator pair. The strain carries resistance to paromomycin.

Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.

From Chun Sing Lau, Mackinder lab, University of York, July 2023

This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of PRK1 (Cre12.g554800) as a fusion protein with a C-terminal TurboID and 3xHA tag using the PSAD promoter/terminator pair. The strain carries resistance to paromomycin.

Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.

From Chun Sing Lau, Mackinder lab, University of York, July 2023

This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of EPYC1 (Cre10.g436550) as a fusion protein with a C-terminal TurboID and 3xHA tag using the PSAD promoter/terminator pair. The strain carries resistance to paromomycin.

Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.

From Chun Sing Lau, Mackinder lab, University of York, July 2023

This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of RBCS2 (Cre02.g120150) as a fusion protein with a C-terminal TurboID and mCherry tag using the PSAD promoter/terminator pair. The strain carries resistance to hygromycin.

Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.

From Chun Sing Lau, Mackinder lab, University of York, July 2023

This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of RPE1 (Cre12.g511900) as a fusion protein with a C-terminal TurboID and mCherry tag using the PSAD promoter/terminator pair. The strain carries resistance to paromomycin.

Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.

From Chun Sing Lau, Mackinder lab, University of York, July 2023

This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of PRK1 (Cre12.g554800) as a fusion protein with a C-terminal TurboID and mCherry using the PSAD promoter/terminator pair. The strain carries resistance to paromomycin.

Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.

From Chun Sing Lau, Mackinder lab, University of York, July 2023

This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of EPYC1 (Cre10.g436550) as a fusion protein with a C-terminal TurboID and 3xHA tag using the PSAD promoter/terminator pair. The strain carries resistance to paromomycin.

Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.

From Chun Sing Lau, Mackinder lab, University of York, July 2023

This strain was obtained by transformation of the epyc1 mutant (https://doi.org/10.1073/pnas.1522866113) using a plasmid which drives expression of RBCS2 (Cre02.g120150) as a fusion protein with a C-terminal TurboID and 3xHA tag using the PSAD promoter/terminator pair. The strain carries resistance to both hygromycin and paromomycin resistance.

Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.

From Chun Sing Lau, Mackinder lab, University of York, July 2023

This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of RBCS2 (Cre02.g120150) as a fusion protein with a C-terminal APEX2 and 3xFlag tag using the PSAD promoter/terminator pair. The strain carries resistance to hygromycin.

Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.

From Chun Sing Lau, Mackinder lab, University of York, July 2023

This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of STR16 (Cre13.g573250) as a fusion protein with a C-terminal mScarlet-I and 3xFlag tag using its native promoter. The strain carries resistance to hygromycin.

Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.

From Chun Sing Lau, Mackinder lab, University of York, July 2023

This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of STR18 (Cre16.g663150) as a fusion protein with a C-terminal Venus and 3xFlag tag using its native promoter. The strain carries resistance to paromomycin.

Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.

From Chun Sing Lau, Mackinder lab, University of York, July 2023

This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of protein encoded by Cre09.g394510 as a fusion protein with a C-terminal Venus and 3xFlag tag using its native promoter. The strain carries resistance to paromomycin.

Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.

From Chun Sing Lau, Mackinder lab, University of York, July 2023

This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of ABCF6 (Cre06.g271850) as a fusion protein with a C-terminal Venus and 3xFlag tag using its native promoter. The strain carries resistance to paromomycin.

Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.

From Chun Sing Lau, Mackinder lab, University of York, July 2023

This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of protein encoded by Cre03.g172700 as a fusion protein with a C-terminal Venus and 3xFlag tag using its native promoter. The strain carries resistance to paromomycin.

Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.

From Chun Sing Lau, Mackinder lab, University of York, July 2023

This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of SMC7 (Cre17.g720450) as a fusion protein with a C-terminal Venus and 3xFlag tag using its native promoter. The strain carries resistance to paromomycin.

Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.

From Chun Sing Lau, Mackinder lab, University of York, July 2023

This strain was obtained by transformation of CC-4533 using a plasmid which drives expression of protein encoded by Cre02.g093650 as a fusion protein with a C-terminal Venus and 3xFlag tag using its native promoter. The strain carries resistance to paromomycin.

Lau CS, Dowle A, Thomas GH, Girr P, Mackinder LCM. A phase-separated CO2-fixing pyrenoid proteome determined by TurboID in Chlamydomonas reinhardtii. Plant Cell. 2023 Sep 1;35(9):3260-3279. doi: 10.1093/plcell/koad131. PMID: 37195994; PMCID: PMC10473203.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023

This is a strain with a point mutation E90R in ChR2 and disrupted ChR1. The strain was generated with CRISPR/Cas9.

Background strain: CC-125 mt+ 
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); CTATGTGTGCGCTATCGAGG (ChR2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab

http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is a published strain. Please cite it accordingly: Baidukova O., Oppermann J., Kelterborn S., Fernandez Lahore R.G., Schumacher D., Evers H., Kamrani Y.Y. and Hegemann P. (2022) Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat. Commun. 13, 7253. https://doi.org/10.1038/s41467-022-35018-6

Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023

This is a strain with a point mutation E90R in ChR2 and disrupted ChR1. The strain was generated with CRISPR/Cas9.

Background strain: CC-125 mt+ 
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); CTATGTGTGCGCTATCGAGG (ChR2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab

http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is a published strain. Please cite it accordingly: Baidukova O., Oppermann J., Kelterborn S., Fernandez Lahore R.G., Schumacher D., Evers H., Kamrani Y.Y. and Hegemann P. (2022) Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat. Commun. 13, 7253. https://doi.org/10.1038/s41467-022-35018-6

Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.