Strains

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023

This is a strain with a point mutation E90Q in ChR2 and disrupted ChR1, which was generated with CRISPR/Cas9. The original strain PH198 with CC125 as a background was crossed into CC124.

Background strain: PH198, CC124 mt-
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); CTATGTGTGCGCTATCGAGG (ChR2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab

http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023

This is a strain with a point mutation E162T in ChR1 and disrupted ChR2, which was generated with CRISPR/Cas9. The original strain PH180 with CC125 as a background was crossed into CC124.

Background strain: CC124 mt-, PH180
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); CTATGTGTGCGCTATCGAGG (ChR2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab

http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023

This is a strain with a point mutation E90Q in ChR2 and disrupted ChR1. The strain was generated with CRISPR/Cas9.

Background strain: CC-125 mt+ 
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); CTATGTGTGCGCTATCGAGG (ChR2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab

http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is a published strain. Please cite it accordingly: Baidukova O., Oppermann J., Kelterborn S., Fernandez Lahore R.G., Schumacher D., Evers H., Kamrani Y.Y. and Hegemann P. (2022) Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat. Commun. 13, 7253. https://doi.org/10.1038/s41467-022-35018-6

Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023

This is a strain with a point mutation K93S in ChR2 and disrupted ChR1. The strain was generated with CRISPR/Cas9.

Background strain: CC-125 mt+ 
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); GACCCGAACGCAGATGGTCA (ChR2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab

http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Simon Kelterborn and Franzisca Bohning, Peter Hegemann lab, Humboldt University-Berlin, July 2023

This is a strain with a point mutation E123T in ChR2 and disrupted ChR1. The strain was generated with CRISPR/Cas9.

Background strain: CC-3403 mt-
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); AGTGGTTGCGTTACGCCGAG (ChR2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab

http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023

This is a strain with a point mutation E123T in ChR2 and disrupted ChR1. The strain was generated with CRISPR/Cas9.

Background strain: CC-125 mt+ 
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); AGTGGTTGCGTTACGCCGAG (ChR2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab

http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is a published strain. Please cite it accordingly: Baidukova O., Oppermann J., Kelterborn S., Fernandez Lahore R.G., Schumacher D., Evers H., Kamrani Y.Y. and Hegemann P. (2022) Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat. Commun. 13, 7253. https://doi.org/10.1038/s41467-022-35018-6

Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023

This is a strain with a point mutation E123T in ChR2 and disrupted ChR1. The strain was generated with CRISPR/Cas9.

Background strain: CC-125 mt+ 
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); AGTGGTTGCGTTACGCCGAG (ChR2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab

http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is a published strain. Please cite it accordingly: Baidukova O., Oppermann J., Kelterborn S., Fernandez Lahore R.G., Schumacher D., Evers H., Kamrani Y.Y. and Hegemann P. (2022) Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat. Commun. 13, 7253. https://doi.org/10.1038/s41467-022-35018-6

Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023

This is a strain with a point mutation E90R in ChR2 and disrupted ChR1. The strain was generated with CRISPR/Cas9.

Background strain: CC-125 mt+ 
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); CTATGTGTGCGCTATCGAGG (ChR2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab

http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023

This is a strain with a point mutation E162T in ChR1 and disrupted ChR2. The strain was generated with CRISPR/Cas9.

Background strain: CC-125 mt+, CC5959 (PH106)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75); pCrZ3 (pPH68)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); CTATGTGTGCGCTATCGAGG (ChR2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab

http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is a published strain. Please cite it accordingly: Baidukova O., Oppermann J., Kelterborn S., Fernandez Lahore R.G., Schumacher D., Evers H., Kamrani Y.Y. and Hegemann P. (2022) Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat. Commun. 13, 7253. https://doi.org/10.1038/s41467-022-35018-6

Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023

This is a strain with a point mutation E162T in ChR1 and disrupted ChR2. The strain was generated with CRISPR/Cas9.

Background strain: CC-125 mt+, CC5959 (PH106)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360); pAPHVIII (pPH75); pCrZ3 (pPH68)
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); CTATGTGTGCGCTATCGAGG (ChR2)

Overview of all CRISPR/Cas9 strains from the Hegemann lab

http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is a published strain. Please cite it accordingly: Baidukova O., Oppermann J., Kelterborn S., Fernandez Lahore R.G., Schumacher D., Evers H., Kamrani Y.Y. and Hegemann P. (2022) Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat. Commun. 13, 7253. https://doi.org/10.1038/s41467-022-35018-6

Baidukova O, Oppermann J, Kelterborn S, Fernandez Lahore RG, Schumacher D, Evers H, Kamrani YY, Hegemann P. Gating and ion selectivity of Channelrhodopsins are critical for photo-activated orientation of Chlamydomonas as shown by in vivo point mutation. Nat Commun. 2022 Nov 25;13(1):7253. doi: 10.1038/s41467-022-35018-6. PMID: 36433995; PMCID: PMC9700795.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University-Berlin, July 2023

This is a strain with a disrupted COP6 (HKR2). The strain was generated with CRISPR/Cas9.

Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: COP6 (HKR2), Cre11.g467678
Target sequence: GTTGTCTTCGAACAAGAGCG

 

Overview of all CRISPR/Cas9 strains from the Hegemann lab

http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Yousef Yari Kamrani and Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, July 2023

This is a FixL-like PAS domain protein disruption strain, generated with CRISPR/Cas9.

Background strain: ROC75-Luc+ (from Takuya Matsuo, see Niwa et al. 2013 for details)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAphVII (pPH360)
Target gene: Cre13.g587550   
Target sequence:TCGGCTAAGGACAACGATGA TGG (Exon 1)

Overview of all CRISPR/Cas9 strains from the Hegemann lab
http://www.chlamy.de/strains

Visit www.chlamy.de for more info or contact CRISPR@chlamy.de

This is an unpublished strain. Please contact ph@chlamy.de before using it.

From Saul Purton, University College London, August 2023

Origin: psbH::aadA knockout in which part of the psbH coding region and 3’ UTR is replaced with the aadA cassette through chloroplast transformation

Culture maintenance: Acetate-requiring, light-sensitive (ΔPSII mutant)

This strain was created to serve as a recipient for ‘marker-free’ chloroplast transformation where selection is based on restoration of phototrophy using the WT psbH gene as the marker. This strain has the same psbH::aadA genotype as strain TN72 (see: CC-5168) but was created using the cell-walled wild-type strain CC-1690 rather that a cell-wall deficient strain carrying the cw15 nuclear lesion. HT72 is therefore suitable for transformation using the microparticle bombardment method. 

Wannathong T, Waterhouse JC, Young RE, Economou CK, Purton S. New tools for chloroplast genetic engineering allow the synthesis of human growth hormone in the green alga Chlamydomonas reinhardtii. Appl Microbiol Biotechnol. 2016 Jun;100(12):5467-77. doi: 10.1007/s00253-016-7354-6. Epub 2016 Feb 18. PMID: 26887319; PMCID: PMC4875957.

Larrea-Alvarez M, Young R, Purton S. A Simple Technology for Generating Marker-Free Chloroplast Transformants of the Green Alga Chlamydomonas reinhardtii. Methods Mol Biol. 2021;2317:293-304. doi: 10.1007/978-1-0716-1472-3_17. PMID: 34028777.

From Adrien Burlacot, Carnegie Institution for Science, August 2023

Origin: Electroporation with pAR-mtHSP70C-Clover-tPSAD, selected on hygromycin 20ug/mL

Culture maintenance: Low light

Algal CO2 capture is powered by alternative electron pathways of photosynthesis. Gilles Peltier, Carolyne Stoffel, Justin Findinier, Sai Kiran Madireddi, Ousmane Dao, Virginie Epting, Arthur Grossman, Yonghua Li-Beisson, Adrien Burlacot. bioRxiv 2023.08.08.552514; doi: https://doi.org/10.1101/2023.08.08.552514

From Adrien Burlacot, Carnegie Institution for Science, August 2023

Background: CC-5325 

Origin: Electroporation with pAR-mtHSP70C-Clover-tPSAD, selected on hygromycin 20ug/mL

Culture maintenance: Low light

Chaux F, Burlacot A, Mekhalfi M, Auroy P, Blangy S, Richaud P, Peltier G. Flavodiiron Proteins Promote Fast and Transient O2 Photoreduction in Chlamydomonas. Plant Physiol. 2017 Jul;174(3):1825-1836. doi: 10.1104/pp.17.00421. Epub 2017 May 9. PMID: 28487478; PMCID: PMC5490913.

Algal CO2 capture is powered by alternative electron pathways of photosynthesis. Gilles Peltier, Carolyne Stoffel, Justin Findinier, Sai Kiran Madireddi, Ousmane Dao, Virginie Epting, Arthur Grossman, Yonghua Li-Beisson, Adrien Burlacot. bioRxiv 2023.08.08.552514; doi: https://doi.org/10.1101/2023.08.08.552514

From Adrien Burlacot, Carnegie Institution for Science, August 2023

Background: 137AH

Origin: Electroporation with pAR-mtHSP70C-Clover-tPSAD, selected on hygromycin 20ug/mL

Culture maintenance: Low light

Tolleter D, Ghysels B, Alric J, Petroutsos D, Tolstygina I, Krawietz D, Happe T, Auroy P, Adriano JM, Beyly A, Cuiné S, Plet J, Reiter IM, Genty B, Cournac L, Hippler M, Peltier G. Control of hydrogen photoproduction by the proton gradient generated by cyclic electron flow in Chlamydomonas reinhardtii. Plant Cell. 2011 Jul;23(7):2619-30. doi: 10.1105/tpc.111.086876. Epub 2011 Jul 15. PMID: 21764992; PMCID: PMC3226202.

Algal CO2 capture is powered by alternative electron pathways of photosynthesis. Gilles Peltier, Carolyne Stoffel, Justin Findinier, Sai Kiran Madireddi, Ousmane Dao, Virginie Epting, Arthur Grossman, Yonghua Li-Beisson, Adrien Burlacot. bioRxiv 2023.08.08.552514; doi: https://doi.org/10.1101/2023.08.08.552514

From Adrien Burlacot, Carnegie Institution for Science, August 2023

Background: flvB_21 crossed with pgrl1

Origin: Electroporation with pAR-mtHSP70C-Clover-tPSAD, selected on hygromycin 20ug/mL

Culture maintenance: Low light

Algal CO2 capture is powered by alternative electron pathways of photosynthesis. Gilles Peltier, Carolyne Stoffel, Justin Findinier, Sai Kiran Madireddi, Ousmane Dao, Virginie Epting, Arthur Grossman, Yonghua Li-Beisson, Adrien Burlacot. bioRxiv 2023.08.08.552514; doi: https://doi.org/10.1101/2023.08.08.552514

From Adrien Burlacot, Carnegie Institution for Science, August 2023

Background: flvB_21 crossed with pgrl1

Origin: Electroporation with pAR-mtHSP70C-Clover-tPSAD, selected on hygromycin 20ug/mL

Culture maintenance: Low light

Algal CO2 capture is powered by alternative electron pathways of photosynthesis. Gilles Peltier, Carolyne Stoffel, Justin Findinier, Sai Kiran Madireddi, Ousmane Dao, Virginie Epting, Arthur Grossman, Yonghua Li-Beisson, Adrien Burlacot. bioRxiv 2023.08.08.552514; doi: https://doi.org/10.1101/2023.08.08.552514

From Adrien Burlacot, Carnegie Institution for Science, August 2023

Background: flvB_21 crossed with pgrl1

Origin: Electroporation with pAR-mtHSP70C-Clover-tPSAD, selected on hygromycin 20ug/mL

Culture maintenance: Low light

Algal CO2 capture is powered by alternative electron pathways of photosynthesis. Gilles Peltier, Carolyne Stoffel, Justin Findinier, Sai Kiran Madireddi, Ousmane Dao, Virginie Epting, Arthur Grossman, Yonghua Li-Beisson, Adrien Burlacot. bioRxiv 2023.08.08.552514; doi: https://doi.org/10.1101/2023.08.08.552514

From Tomohiro Kubo, University of Yamanashi-Japan, August 2023

Phenotype: Normal phenotype

Background: tua1(int1)

Origin: Generated by a CRISPR/Cas9 mediated gene editing; a paromomycin-resistant gene cassette was inserted into the intron 1 of TUA2 (Cre04.g216850); a hygromycin-resistant gene cassette was inserted into the region near 3’UTR of TUA1 (Cre03.g190950)

Kubo T, Tani Y, Yanagisawa HA, Kikkawa M, Oda T. α- and β-tubulin C-terminal tails with distinct modifications are crucial for ciliary motility and assembly. J Cell Sci. 2023 Aug 15;136(16):jcs261070. doi: 10.1242/jcs.261070. Epub 2023 Aug 17. PMID: 37519241.

From Tomohiro Kubo, University of Yamanashi-Japan, August 2023

Phenotype: Lacks motility

Background: tua1(int1)

Origin: Generated by a CRISPR/Cas9 mediated gene editing; a paromomycin-resistant gene cassette was inserted into the intron 1 of TUA2 (Cre04.g216850); a hygromycin-resistant gene cassette was inserted into the region near 3’UTR of TUA1 (Cre03.g190950); four glutamate residues (E445, E447, E449, and E450) in TUA1 C-terminus region are all substituted to alanine

Kubo T, Tani Y, Yanagisawa HA, Kikkawa M, Oda T. α- and β-tubulin C-terminal tails with distinct modifications are crucial for ciliary motility and assembly. J Cell Sci. 2023 Aug 15;136(16):jcs261070. doi: 10.1242/jcs.261070. Epub 2023 Aug 17. PMID: 37519241.

From Tomohiro Kubo, University of Yamanashi-Japan, August 2023

Phenotype: Normal phenotype

Background: CC-124

Origin: Generated by a CRISPR/Cas9 mediated gene editing; a paromomycin-resistant gene cassette was inserted into the intron 2 of TUB1 (Cre12.g542250)

Kubo T, Tani Y, Yanagisawa HA, Kikkawa M, Oda T. α- and β-tubulin C-terminal tails with distinct modifications are crucial for ciliary motility and assembly. J Cell Sci. 2023 Aug 15;136(16):jcs261070. doi: 10.1242/jcs.261070. Epub 2023 Aug 17. PMID: 37519241.

From Tomohiro Kubo, University of Yamanashi-Japan, August 2023

Phenotype: Normal phenotype

Background: tub1(int2)

Origin: Generated by a CRISPR/Cas9 mediated gene editing; a paromomycin-resistant gene cassette was inserted into the intron 2 of TUB1 (Cre12.g542250); a hygromycin-resistant gene cassette was inserted into the region near 3’UTR of TUB2 (Cre12.g549550)

Kubo T, Tani Y, Yanagisawa HA, Kikkawa M, Oda T. α- and β-tubulin C-terminal tails with distinct modifications are crucial for ciliary motility and assembly. J Cell Sci. 2023 Aug 15;136(16):jcs261070. doi: 10.1242/jcs.261070. Epub 2023 Aug 17. PMID: 37519241.

From Tomohiro Kubo, University of Yamanashi-Japan, August 2023

Phenotype: Impaired swimming motility

Background: tub1(int2)

Origin: Generated by a CRISPR/Cas9 mediated gene editing; a paromomycin-resistant gene cassette was inserted into the intron 2 of TUB1 (Cre12.g542250); a hygromycin-resistant gene cassette was inserted into the region near 3’UTR of TUB2 (Cre12.g549550); atop codon was inserted into TUB2 gene to eliminate four glutamate residues (E439, E440, E441, and E442) in the C-terminus region

Kubo T, Tani Y, Yanagisawa HA, Kikkawa M, Oda T. α- and β-tubulin C-terminal tails with distinct modifications are crucial for ciliary motility and assembly. J Cell Sci. 2023 Aug 15;136(16):jcs261070. doi: 10.1242/jcs.261070. Epub 2023 Aug 17. PMID: 37519241.

From Tomohiro Kubo, University of Yamanashi-Japan, August 2023

Phenotype: Impaired swimming motility with short flagella lacking the central-pair microtubules

Background: tub1(int2)

Origin: Generated by a CRISPR/Cas9 mediated gene editing; a paromomycin-resistant gene cassette was inserted into the intron 2 of TUB1 (Cre12.g542250); a hygromycin-resistant gene cassette was inserted into the region near 3’UTR of TUB2 (Cre12.g549550), a stop codon was inserted into TUB2 gene to eliminate six glutamate residues (E431, E432, E433, E439, E440, E441, and E442) in the C-terminus region

Kubo T, Tani Y, Yanagisawa HA, Kikkawa M, Oda T. α- and β-tubulin C-terminal tails with distinct modifications are crucial for ciliary motility and assembly. J Cell Sci. 2023 Aug 15;136(16):jcs261070. doi: 10.1242/jcs.261070. Epub 2023 Aug 17. PMID: 37519241.

From Gui Zhang, Karl Lechtreck lab, University of Georgia, November 2023

This strain, originally from George Witman and Yuqing Hou, is a kap null mutant generated in g1/CC-5415. 

Lechtreck KF. Methods for Studying Movement of Molecules Within Cilia. Methods Mol Biol. 2016;1454:83-96. doi: 10.1007/978-1-4939-3789-9_6. PMID: 27514917; PMCID: PMC5269603.

Li S, Wan KY, Chen W, Tao H, Liang X, Pan J. Functional exploration of heterotrimeric kinesin-II in IFT and ciliary length control in Chlamydomonas. Elife. 2020 Oct 28;9:e58868. doi: 10.7554/eLife.58868. PMID: 33112235; PMCID: PMC7652414.

  • Locus:
  • FLA3
  • Chromosome:
  • 10

From Gui Zhang, Karl Lechtreck lab, University of Georgia, November 2023

This is kap null mutant was rescued with sfGFP-KAP (Patel et al.) in the pBR-2xsfGFP backbone (described in Lechtreck 2016) and is zeocin resistant.

Lechtreck KF. Methods for Studying Movement of Molecules Within Cilia. Methods Mol Biol. 2016;1454:83-96. doi: 10.1007/978-1-4939-3789-9_6. PMID: 27514917; PMCID: PMC5269603.

Li S, Wan KY, Chen W, Tao H, Liang X, Pan J. Functional exploration of heterotrimeric kinesin-II in IFT and ciliary length control in Chlamydomonas. Elife. 2020 Oct 28;9:e58868. doi: 10.7554/eLife.58868. PMID: 33112235; PMCID: PMC7652414.

  • Locus:
  • FLA3
  • Chromosome:
  • 10

From Gui Zhang, Karl Lechtreck lab, University of Georgia, November 2023

CC-1396 fla8 mt- was rescued with the FLA8-YFP construct described in Li et al. 2020 and is hygromycin resistant. Isolate A4.

Lechtreck KF. Methods for Studying Movement of Molecules Within Cilia. Methods Mol Biol. 2016;1454:83-96. doi: 10.1007/978-1-4939-3789-9_6. PMID: 27514917; PMCID: PMC5269603.

Li S, Wan KY, Chen W, Tao H, Liang X, Pan J. Functional exploration of heterotrimeric kinesin-II in IFT and ciliary length control in Chlamydomonas. Elife. 2020 Oct 28;9:e58868. doi: 10.7554/eLife.58868. PMID: 33112235; PMCID: PMC7652414.

  • Locus:
  • FLA8
  • Chromosome:
  • 12

From Gui Zhang, Karl Lechtreck lab, University of Georgia, November 2023

CC-1396 fla8 mt- was rescued with the FLA8-YFP construct described in Li et al. 2020 and is hygromycin resistant. Isolate A12.

Lechtreck KF. Methods for Studying Movement of Molecules Within Cilia. Methods Mol Biol. 2016;1454:83-96. doi: 10.1007/978-1-4939-3789-9_6. PMID: 27514917; PMCID: PMC5269603.

Li S, Wan KY, Chen W, Tao H, Liang X, Pan J. Functional exploration of heterotrimeric kinesin-II in IFT and ciliary length control in Chlamydomonas. Elife. 2020 Oct 28;9:e58868. doi: 10.7554/eLife.58868. PMID: 33112235; PMCID: PMC7652414.

  • Locus:
  • FLA8
  • Chromosome:
  • 12

From Gervette Penny, Susan Dutcher lab, Washington Univerity in St. Loius, November 2023

Genotype: pf23::aphVII; ac17; atg17::aphIII

Strain CC-5909 was transformed with aphVII construct targeted to exon 1 of the PF23 gene using CRISPR/Cas9.

This strain is a null allele of PF23. It lacks cilia under vegetative conditions and has extremetly short, stubby cilia as gametes. It does not grow in medium lacking acetate and is resistant to hygromycin and paromomycin.

Penny GM, Dutcher SK. Gene dosage of independent dynein arm motor preassembly factors influences cilia assembly in Chlamydomonas reinhardtii. PLoS Genet. 2024 Mar 18;20(3):e1011038. doi: 10.1371/journal.pgen.1011038. PMID: 38498551; PMCID: PMC11020789.

Payne ZL, Penny GM, Turner TN, Dutcher SK. A gap-free genome assembly of Chlamydomonas reinhardtii and detection of translocations induced by CRISPR-mediated mutagenesis. Plant Commun. 2023 Mar 13;4(2):100493. doi: 10.1016/j.xplc.2022.100493. Epub 2022 Nov 17. PMID: 36397679; PMCID: PMC10030371.

Lin H, Cliften PF, Dutcher SK. MAPINS, a Highly Efficient Detection Method That Identifies Insertional Mutations and Complex DNA Rearrangements. Plant Physiol. 2018 Dec;178(4):1436-1447. doi: 10.1104/pp.18.00474. Epub 2018 Sep 11. PMID: 30206105; PMCID: PMC6288735.

  • Locus:
  • PF23, AC17, ATG17
  • Chromosome:
  • 11, 3, 16