Strains

From Justin Findinier, Grossman lab, Carnegie Institution, Stanford CA, April 2024

Locus: Cre08.g375200
Background: CC-125 mito-Clover
Origin: in lab, CRISPR knock-out of MIRO1 gene with paromomycin cassette insertion
Culture maintenance: low light (30-50uE) with acetate

Justin Findinier, Lydia-Marie Joubert, Michael F. Schmid, Andrey Malkovskiy, Wah Chiu, Adrien Burlacot, Arthur R. Grossman. Dramatic Changes in Mitochondrial Subcellular Location and Morphology Accompany Activation of the CO2 Concentrating Mechanism. bioRxiv 2024.03.25.586705; doi: https://doi.org/10.1101/2024.03.25.586705

  • Locus:
  • Cre08.g375200
  • Chromosome:
  • 8

From Justin Findinier, Grossman lab, Carnegie Institution, Stanford CA, April 2024

Locus: Cre08.g375200
Background: CC-125 mito-Clover
Origin: in lab, CRISPR knock-out of MIRO1 gene with paromomycin cassette insertion
Culture maintenance: low light (30-50uE) with acetate

Justin Findinier, Lydia-Marie Joubert, Michael F. Schmid, Andrey Malkovskiy, Wah Chiu, Adrien Burlacot, Arthur R. Grossman. Dramatic Changes in Mitochondrial Subcellular Location and Morphology Accompany Activation of the CO2 Concentrating Mechanism. bioRxiv 2024.03.25.586705; doi: https://doi.org/10.1101/2024.03.25.586705

  • Locus:
  • Chromosome:
  • Cre08.g375200

From Justin Findinier, Grossman lab, Carnegie Institution, Stanford CA, April 2024

Locus: Cre08.g375200
Background: miro1-2
Origin: in lab, miro1-2 transformation with spectinomycin plasmid containing a N-terminal fusion of MIRO1 with the mCherry fluorophore and under the PSAD promoter control.
Culture maintenance: low light (30-50uE) with acetate

Justin Findinier, Lydia-Marie Joubert, Michael F. Schmid, Andrey Malkovskiy, Wah Chiu, Adrien Burlacot, Arthur R. Grossman. Dramatic Changes in Mitochondrial Subcellular Location and Morphology Accompany Activation of the CO2 Concentrating Mechanism. bioRxiv 2024.03.25.586705; doi: https://doi.org/10.1101/2024.03.25.586705

  • Locus:
  • Cre08.g375200
  • Chromosome:
  • 8

From Justin Findinier, Grossman lab, Carnegie Institution, Stanford CA, April 2024

Locus: Cre12.g524500
Background: rmt2-2
Origin: in lab, rmt2-2 transformation with zeocin plasmid containing a C-terminal fusion of RMT2 with the mNeonGreen fluorophore and under the RMT2 promoter control.
Culture maintenance: low light (30-50uE) with acetate

Rick G. Kim, Weichao Huang, Justin Findinier, Freddy Bunbury, Petra Redekop, Ruben Shrestha, TaraBryn S Grismer, Josep Vilarrasa-Blasi, Robert E. Jinkerson, Neda Fakhimi, Friedrich Fauser, Martin C. Jonikas, Masayuki Onishi, Shou-Ling Xu, Arthur R. Grossman. Chloroplast Methyltransferase Homolog RMT2 is Involved in Photosystem I Biogenesis. bioRxiv 2023.12.21.572672; doi: https://doi.org/10.1101/2023.12.21.572672

  • Locus:
  • Cre12.g524500
  • Chromosome:
  • 12

From Justin Findinier, Grossman lab, Carnegie Institution, Stanford CA, April 2024

Locus: Cre01.g045550
Background: M10
Origin: in lab, CRISPR knock out of TPT3 gene with hygromycin cassette insertion
Culture maintenance: low light (30-50uE) with acetate

Huang W, Krishnan A, Plett A, Meagher M, Linka N, Wang Y, Ren B, Findinier J, Redekop P, Fakhimi N, Kim RG, Karns DA, Boyle N, Posewitz MC, Grossman AR. Chlamydomonas mutants lacking chloroplast TRIOSE PHOSPHATE TRANSPORTER3 are metabolically compromised and light sensitive. Plant Cell. 2023 Jun 26;35(7):2592-2614. doi: 10.1093/plcell/koad095. PMID: 36970811; PMCID: PMC10291034.

  • Locus:
  • Cre01.g045550
  • Chromosome:
  • 1

From Justin Findinier, Grossman lab, Carnegie Institution, Stanford CA, April 2024

Locus: Cre01.g045550
Background: M10
Origin: in lab, tpt3-ko2 transformation with hygromycin plasmid containing TPT3 gene. Strain selected under high light.
Culture maintenance: low light (30-50uE) with acetate

Huang W, Krishnan A, Plett A, Meagher M, Linka N, Wang Y, Ren B, Findinier J, Redekop P, Fakhimi N, Kim RG, Karns DA, Boyle N, Posewitz MC, Grossman AR. Chlamydomonas mutants lacking chloroplast TRIOSE PHOSPHATE TRANSPORTER3 are metabolically compromised and light sensitive. Plant Cell. 2023 Jun 26;35(7):2592-2614. doi: 10.1093/plcell/koad095. PMID: 36970811; PMCID: PMC10291034.

  • Locus:
  • Cre01.g045550
  • Chromosome:
  • 1

From Justin Findinier, Grossman lab, Carnegie Institution, Stanford CA, April 2024

Locus: Cre06.g263850
Background: M10
Origin: in lab, CRISPR knock out of TPT2 gene with hygromycin cassette insertion
Culture maintenance: low light (30-50uE) with acetate

Huang W, Krishnan A, Plett A, Meagher M, Linka N, Wang Y, Ren B, Findinier J, Redekop P, Fakhimi N, Kim RG, Karns DA, Boyle N, Posewitz MC, Grossman AR. Chlamydomonas mutants lacking chloroplast TRIOSE PHOSPHATE TRANSPORTER3 are metabolically compromised and light sensitive. Plant Cell. 2023 Jun 26;35(7):2592-2614. doi: 10.1093/plcell/koad095. PMID: 36970811; PMCID: PMC10291034.

  • Locus:
  • Cre06.g263850
  • Chromosome:
  • 6

If you use this mutant for your work, please cite: Li et al. 2019 Nature Genetics.

From Moshe Kafri, Jonikas lab, Princeton University, May 2024

The CLiP strain LMJ.RY0402.234057 (with mutation in cpld64 genes) was rescued by pRAM118 based plasmid with Cre12.g485850-Venus-3xFLAG. This strain includes abiotic resistance for paromomycin and hygromycin.

Kafri M, Patena W, Martin L, Wang L, Gomer G, Ergun SL, Sirkejyan AK, Goh A, Wilson AT, Gavrilenko SE, Breker M, Roichman A, McWhite CD, Rabinowitz JD, Cross FR, Wühr M, Jonikas MC. Systematic identification and characterization of genes in the regulation and biogenesis of photosynthetic machinery. Cell. 2023 Dec 7;186(25):5638-5655.e25. doi: 10.1016/j.cell.2023.11.007. PMID: 38065083; PMCID: PMC10760936.

  • Locus:
  • Cre12.g485850
  • Chromosome:
  • 12

If you use this mutant for your work, please cite: Li et al. 2019 Nature Genetics.

From Moshe Kafri, Jonikas lab, Princeton University, May 2024

The CLiP strain LMJ.RY0402.228123 (with mutation in chlm genes) was rescued by pRAM118 based plasmid with Cre12.g498550-Venus-3xFLAG. This strain includes abiotic resistance for paromomycin and hygromycin.

Kafri M, Patena W, Martin L, Wang L, Gomer G, Ergun SL, Sirkejyan AK, Goh A, Wilson AT, Gavrilenko SE, Breker M, Roichman A, McWhite CD, Rabinowitz JD, Cross FR, Wühr M, Jonikas MC. Systematic identification and characterization of genes in the regulation and biogenesis of photosynthetic machinery. Cell. 2023 Dec 7;186(25):5638-5655.e25. doi: 10.1016/j.cell.2023.11.007. PMID: 38065083; PMCID: PMC10760936.

  • Locus:
  • Cre12.g498550
  • Chromosome:
  • 12

If you use this mutant for your work, please cite: Li et al. 2019 Nature Genetics.

From Moshe Kafri, Jonikas lab, Princeton University, May 2024

The CLiP strain LMJ.RY0402.044496 (with mutation in pir1 genes) was rescued by pRAM118 based plasmid with Cre01.g014000-Venus-3xFLAG. This strain includes abiotic resistance for paromomycin and hygromycin.

Kafri M, Patena W, Martin L, Wang L, Gomer G, Ergun SL, Sirkejyan AK, Goh A, Wilson AT, Gavrilenko SE, Breker M, Roichman A, McWhite CD, Rabinowitz JD, Cross FR, Wühr M, Jonikas MC. Systematic identification and characterization of genes in the regulation and biogenesis of photosynthetic machinery. Cell. 2023 Dec 7;186(25):5638-5655.e25. doi: 10.1016/j.cell.2023.11.007. PMID: 38065083; PMCID: PMC10760936.

  • Locus:
  • Cre01.g014000
  • Chromosome:
  • 1

If you use this mutant for your work, please cite: Li et al. 2019 Nature Genetics.

From Moshe Kafri, Jonikas lab, Princeton University, May 2024

The CLiP strain LMJ.RY0402.057931 (with mutation in cgl54 genes) was rescued by pRAM118 based plasmid with Cre02.g073850-Venus-3xFLAG. This strain includes abiotic resistance for paromomycin and hygromycin.

Kafri M, Patena W, Martin L, Wang L, Gomer G, Ergun SL, Sirkejyan AK, Goh A, Wilson AT, Gavrilenko SE, Breker M, Roichman A, McWhite CD, Rabinowitz JD, Cross FR, Wühr M, Jonikas MC. Systematic identification and characterization of genes in the regulation and biogenesis of photosynthetic machinery. Cell. 2023 Dec 7;186(25):5638-5655.e25. doi: 10.1016/j.cell.2023.11.007. PMID: 38065083; PMCID: PMC10760936.

  • Locus:
  • Cre02.g073850
  • Chromosome:
  • 2

If you use this mutant for your work, please cite: Li et al. 2019 Nature Genetics.

From Moshe Kafri, Jonikas lab, Princeton University, May 2024

The CLiP strain LMJ.RY0402.248779 (with mutation in pmr1 genes) was rescued by pRAM118 based plasmid with Cre10.g448950-Venus-3xFLAG. This strain includes abiotic resistance for paromomycin and hygromycin.

Kafri M, Patena W, Martin L, Wang L, Gomer G, Ergun SL, Sirkejyan AK, Goh A, Wilson AT, Gavrilenko SE, Breker M, Roichman A, McWhite CD, Rabinowitz JD, Cross FR, Wühr M, Jonikas MC. Systematic identification and characterization of genes in the regulation and biogenesis of photosynthetic machinery. Cell. 2023 Dec 7;186(25):5638-5655.e25. doi: 10.1016/j.cell.2023.11.007. PMID: 38065083; PMCID: PMC10760936.

  • Locus:
  • Cre10.g448950
  • Chromosome:
  • 10

If you use this mutant for your work, please cite: Li et al. 2019 Nature Genetics.

From Moshe Kafri, Jonikas lab, Princeton University, May 2024

The CLiP strain LMJ.RY0402.046095 (with mutation in cpl6 genes) was rescued by pRAM118 based plasmid with Cre06.g279500-Venus-3xFLAG. This strain includes abiotic resistance for paromomycin and hygromycin.

Kafri M, Patena W, Martin L, Wang L, Gomer G, Ergun SL, Sirkejyan AK, Goh A, Wilson AT, Gavrilenko SE, Breker M, Roichman A, McWhite CD, Rabinowitz JD, Cross FR, Wühr M, Jonikas MC. Systematic identification and characterization of genes in the regulation and biogenesis of photosynthetic machinery. Cell. 2023 Dec 7;186(25):5638-5655.e25. doi: 10.1016/j.cell.2023.11.007. PMID: 38065083; PMCID: PMC10760936.

  • Locus:
  • Cre06.g279500
  • Chromosome:
  • 6

If you use this mutant for your work, please cite: Li et al. 2019 Nature Genetics.

From Moshe Kafri, Jonikas lab, Princeton University, May 2024

The CLiP strain LMJ.RY0402.208103 (with mutation in raa6 genes) was rescued by pLM005 based plasmid with Cre07.g350700-Venus-3xFLAG. This strain includes abiotic resistance for paromomycin.

Kafri M, Patena W, Martin L, Wang L, Gomer G, Ergun SL, Sirkejyan AK, Goh A, Wilson AT, Gavrilenko SE, Breker M, Roichman A, McWhite CD, Rabinowitz JD, Cross FR, Wühr M, Jonikas MC. Systematic identification and characterization of genes in the regulation and biogenesis of photosynthetic machinery. Cell. 2023 Dec 7;186(25):5638-5655.e25. doi: 10.1016/j.cell.2023.11.007. PMID: 38065083; PMCID: PMC10760936.

  • Locus:
  • Cre07.g350700
  • Chromosome:
  • 7

If you use this mutant for your work, please cite: Li et al. 2019 Nature Genetics.

From Moshe Kafri, Jonikas lab, Princeton University, May 2024

The CLiP strain LMJ.RY0402.077016 (with mutation in psr1 genes) was rescued by pRAM118 based plasmid with Cre10.g433400-Venus-3xFLAG. This strain includes abiotic resistance for paromomycin and hygromycin.

Kafri M, Patena W, Martin L, Wang L, Gomer G, Ergun SL, Sirkejyan AK, Goh A, Wilson AT, Gavrilenko SE, Breker M, Roichman A, McWhite CD, Rabinowitz JD, Cross FR, Wühr M, Jonikas MC. Systematic identification and characterization of genes in the regulation and biogenesis of photosynthetic machinery. Cell. 2023 Dec 7;186(25):5638-5655.e25. doi: 10.1016/j.cell.2023.11.007. PMID: 38065083; PMCID: PMC10760936.

  • Locus:
  • Cre10.g433400
  • Chromosome:
  • 10

If you use this mutant for your work, please cite: Li et al. 2019 Nature Genetics.

From Moshe Kafri, Jonikas lab, Princeton University, May 2024

The CLiP strain LMJ.RY0402.133008 (with mutation in raa17 genes) was rescued by pLM005 based plasmid with Cre13.g566400-Venus-3xFLAG. This strain includes abiotic resistance for paromomycin.

Kafri M, Patena W, Martin L, Wang L, Gomer G, Ergun SL, Sirkejyan AK, Goh A, Wilson AT, Gavrilenko SE, Breker M, Roichman A, McWhite CD, Rabinowitz JD, Cross FR, Wühr M, Jonikas MC. Systematic identification and characterization of genes in the regulation and biogenesis of photosynthetic machinery. Cell. 2023 Dec 7;186(25):5638-5655.e25. doi: 10.1016/j.cell.2023.11.007. PMID: 38065083; PMCID: PMC10760936.

  • Locus:
  • Cre13.g566400
  • Chromosome:
  • 13

If you use this mutant for your work, please cite: Li et al. 2019 Nature Genetics.

From Moshe Kafri, Jonikas lab, Princeton University, May 2024

The CLiP strain LMJ.RY0402.164167 (with mutation in tba2 genes) was rescued by pRAM118 based plasmid with Cre13.g578650-Venus-3xFLAG. This strain includes abiotic resistance for paromomycin and hygromycin.

Kafri M, Patena W, Martin L, Wang L, Gomer G, Ergun SL, Sirkejyan AK, Goh A, Wilson AT, Gavrilenko SE, Breker M, Roichman A, McWhite CD, Rabinowitz JD, Cross FR, Wühr M, Jonikas MC. Systematic identification and characterization of genes in the regulation and biogenesis of photosynthetic machinery. Cell. 2023 Dec 7;186(25):5638-5655.e25. doi: 10.1016/j.cell.2023.11.007. PMID: 38065083; PMCID: PMC10760936.

  • Locus:
  • Cre13.g578650
  • Chromosome:
  • 13

If you use this mutant for your work, please cite: Li et al. 2019 Nature Genetics.

From Moshe Kafri, Jonikas lab, Princeton University, May 2024

The CLiP strain LMJ.RY0402.207089 (with mutation in tpk1 genes) was rescued by pRAM118 based plasmid with Cre01.g040050-Venus-3xFLAG. This strain includes abiotic resistance for paromomycin and hygromycin.

Kafri M, Patena W, Martin L, Wang L, Gomer G, Ergun SL, Sirkejyan AK, Goh A, Wilson AT, Gavrilenko SE, Breker M, Roichman A, McWhite CD, Rabinowitz JD, Cross FR, Wühr M, Jonikas MC. Systematic identification and characterization of genes in the regulation and biogenesis of photosynthetic machinery. Cell. 2023 Dec 7;186(25):5638-5655.e25. doi: 10.1016/j.cell.2023.11.007. PMID: 38065083; PMCID: PMC10760936.

  • Locus:
  • Cre01.g040050
  • Chromosome:
  • 1

If you use this mutant for your work, please cite: Li et al. 2019 Nature Genetics.

From Moshe Kafri, Jonikas lab, Princeton University, May 2024

The CLiP strain LMJ.RY0402.254076 (with mutation in raa15 genes) was rescued by pLM005 based plasmid with Cre17.g728850-Venus-3xFLAG. This strain includes abiotic resistance for paromomycin.

Kafri M, Patena W, Martin L, Wang L, Gomer G, Ergun SL, Sirkejyan AK, Goh A, Wilson AT, Gavrilenko SE, Breker M, Roichman A, McWhite CD, Rabinowitz JD, Cross FR, Wühr M, Jonikas MC. Systematic identification and characterization of genes in the regulation and biogenesis of photosynthetic machinery. Cell. 2023 Dec 7;186(25):5638-5655.e25. doi: 10.1016/j.cell.2023.11.007. PMID: 38065083; PMCID: PMC10760936.

  • Locus:
  • Cre17.g728850
  • Chromosome:
  • 17

If you use this mutant for your work, please cite: Li et al. 2019 Nature Genetics.

From Moshe Kafri, Jonikas lab, Princeton University, May 2024

The CLiP strain LMJ.RY0402.193706 (with mutation in mtf1 genes) was rescued by pRAM118 based plasmid with Cre12.g560550-Venus-3xFLAG. This strain includes abiotic resistance for paromomycin and hygromycin.

Kafri M, Patena W, Martin L, Wang L, Gomer G, Ergun SL, Sirkejyan AK, Goh A, Wilson AT, Gavrilenko SE, Breker M, Roichman A, McWhite CD, Rabinowitz JD, Cross FR, Wühr M, Jonikas MC. Systematic identification and characterization of genes in the regulation and biogenesis of photosynthetic machinery. Cell. 2023 Dec 7;186(25):5638-5655.e25. doi: 10.1016/j.cell.2023.11.007. PMID: 38065083; PMCID: PMC10760936.

  • Locus:
  • Cre12.g560550
  • Chromosome:
  • 12

If you use this mutant for your work, please cite: Li et al. 2019 Nature Genetics.

From Moshe Kafri, Jonikas lab, Princeton University, May 2024

The CLiP strain LMJ.RY0402.176891 (with mutation in psr5 genes) was rescued by pRAM118 based plasmid with Cre01.g022681-Venus-3xFLAG. This strain includes abiotic resistance for paromomycin and hygromycin.

Kafri M, Patena W, Martin L, Wang L, Gomer G, Ergun SL, Sirkejyan AK, Goh A, Wilson AT, Gavrilenko SE, Breker M, Roichman A, McWhite CD, Rabinowitz JD, Cross FR, Wühr M, Jonikas MC. Systematic identification and characterization of genes in the regulation and biogenesis of photosynthetic machinery. Cell. 2023 Dec 7;186(25):5638-5655.e25. doi: 10.1016/j.cell.2023.11.007. PMID: 38065083; PMCID: PMC10760936.

  • Locus:
  • Cre01.g022681
  • Chromosome:
  • 1

If you use this mutant for your work, please cite: Li et al. 2019 Nature Genetics.

From Moshe Kafri, Jonikas lab, Princeton University, May 2024

The CLiP strain LMJ.RY0402.255772 (with mutation in pbs27 genes) was rescued by pLM005 based plasmid with Cre05.g243800-Venus-3xFLAG. This strain includes abiotic resistance for paromomycin.

Kafri M, Patena W, Martin L, Wang L, Gomer G, Ergun SL, Sirkejyan AK, Goh A, Wilson AT, Gavrilenko SE, Breker M, Roichman A, McWhite CD, Rabinowitz JD, Cross FR, Wühr M, Jonikas MC. Systematic identification and characterization of genes in the regulation and biogenesis of photosynthetic machinery. Cell. 2023 Dec 7;186(25):5638-5655.e25. doi: 10.1016/j.cell.2023.11.007. PMID: 38065083; PMCID: PMC10760936.

  • Locus:
  • Cre05.g243800
  • Chromosome:
  • 5

Deposited by Darius Rauch, Peter Hegemann lab, Humboldt University of Berlin, May 2024.

This is an aCRY disruption strain, generated with CRISPR/Cas9.

Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: pCRY, Cre06.g295200
Target sequence: GCGACATGCTGTATGAGCCG (Exon2)

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Darius Rauch, Peter Hegemann lab, Humboldt University of Berlin, May 2024

This is an aCRY disruption strain, generated with CRISPR/Cas9.

Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: aCRY, Cre06.g278251
Target sequence: GCTGTGTTTTGAGCACGACA (Exon 5)

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Darius Rauch, Peter Hegemann lab, Humboldt University of Berlin, May 2024

This is a pCRY (CPH1) disruption strain, generated with CRISPR/Cas9. The pCRY strain contains an insertion of the marker plasmid pAphVIII (pPH75).

Background strain: SAG 73-72 (from Takuya Matsuo, see Niwa et al. 2013)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: pCRY (CPH1), Cre06.g295200
Target sequence: GCGACATGCTGTATGAGCCG (Exon2)

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Darius Rauch, Peter Hegemann lab, Humboldt University of Berlin, May 2024

This is a pCRY (CPH1) disruption strain, generated with CRISPR/Cas9.

Background strain: SAG 73-72 (from Takuya Matsuo, see Niwa et al. 2013)
Nuclease: (Sp)Cas9 as ribonucleoprotein (RNP)
Marker: pAPHVIII (pPH75)
Target gene: pCRY (CPH1), Cre06.g295200
Target sequence: GCGACATGCTGTATGAGCCG (Exon2)

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2024

This is a strain with a mutated C128 residue to T128 in ChR2 ( = point mutation C128T) and disruption of ChR1, which was generated with SpCas9 in the CC-125 background.

Background strain: CC-125 mt+
Nuclease: SpCas9
Target gene: ChR1, Cre14.g611300; ChR2, Cre02.g085257
Target sequence: TGTGGCTTCGTTACGCGGAG (ChR1); AGTGGTTGCGTTACGCCGAG (ChR2)
Marker: pAPHVIII (pPH75); pAphVII (pPH360)

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2024

This is an AGG3 disruption strain, generated with SpCas9 in the SAG 11-32b background.

Background strain: SAG 11-32b [=CC-409 mt+ = UTEX 90]
Nuclease: SpCas9
Target gene: AGG3, Cre10.g456100
Target sequence: GAAGCCGAACACGAAGCCAT
Marker: pAPHVIII (pPH75)

 

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2024

This is a pCry disruption strain, generated with SpCas9 in the CC-124 background.

Background strain: CC-124
Nuclease: SpCas9
Target gene: pCry, Cre06.g295200
Target sequence: TTAGGGTCCAGCACATCCCA
Marker: pAPHVIII (pPH75)

 

This is an unpublished strain. Please contact ph@chlamy.de before using it.

Deposited by Olga Baidukova, Peter Hegemann lab, Humboldt University of Berlin, May 2024

This is a pCry disruption strain, generated with SpCas9 in the CC-124 background.

Background strain: CC-124
Nuclease: SpCas9
Target gene: pCry, Cre06.g295200
Target sequence: TTAGGGTCCAGCACATCCCA
Marker: pAPHVIII (pPH75)

 

This is an unpublished strain. Please contact ph@chlamy.de before using it.